Labshake search
Citations for New England Biolabs :
6101 - 6150 of 10000+ citations for Mouse Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Poly A selection was performed using NEB Next® Ultra ™ RNA Library Prep Kit (New England Biolabs) and the sequencing libraries (250∼300 bp insert cDNA library ...
-
bioRxiv - Biophysics 2022Quote: ... PCR cleanup was carried out on each amplicon sample using the Monarch PCR cleanup kit (New England Biolabs). The amplicons were then dual-indexed for paired-end read Illumina sequencing using Nextera primers N701 and N702 for the PEL and SUP of the 5.5 h time point and N705 and N706 for the PEL and SUP of the 9.0 h time point ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA was subsequently extracted from T0 plants using Monarch DNA extraction kits (New England Biolabs, Ipswich, MA, USA) and sequence confirmed (CHU de Québec-Université Laval ...
-
bioRxiv - Genomics 2022Quote: ... ChIP libraries were prepared using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB) and NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1 ...
-
bioRxiv - Genomics 2022Quote: ... Quality of the library was analyzed by Bioanalyzer and NEBNext® Library Quant Kit for Illumina® (NEB). IS libraries were sent for sequencing to c.ATG sequencing core facility at Tübingen University and sequenced on a MiSeq instrument 2×150 bp.
-
bioRxiv - Microbiology 2022Quote: ... The online NEBasechanger (https://nebasechanger.neb.com/) was used to design primers and the Q5 Site Directed Mutagenesis Kit (NEB) was used to generate pUPRTKO-ISC6pro-AC9ΔCC-3xTy (primers P13-14) ...
-
bioRxiv - Microbiology 2022Quote: ... Any host RNA and bacterial ribosomal RNA were depleted using the NEBNext rRNA Depletion Kits (New England BioLabs). Isolated RNA was then assessed for quality using the Agilent TapeStation system ...
-
bioRxiv - Genetics 2022Quote: ... Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs; version 6.0 – 2/18) using NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1 (#E7600S ...
-
bioRxiv - Genetics 2022Quote: ... The kanamycin resistance cassette-gDNA junctions were prepared for sequencing using NEB Ultra I kit (New England Biolabs). Following adapter ligation and treatment with the NEB USER Enzyme ...
-
bioRxiv - Bioengineering 2022Quote: mRNAs were transcribed from DNA templates using T7 RNA polymerase (HiScribe T7 High Yield RNA Synthesis Kit, NEB). To generate base modified mRNA variants ...
-
bioRxiv - Cancer Biology 2022Quote: ... AAK1(S-676D/E/A) and UVRAG (T-518D/E/A) using Q5-site directed mutagenesis Kit (NEB). Manufacturer’s instructions for mutagenic primer design were followed ...
-
bioRxiv - Microbiology 2022Quote: ... Resultant fragments were then gel-purified using the Monarch DNA Gel extraction kit (New England Biolabs, MA, USA) and ligated with the T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... UC Berkeley) (Chen et al 2017) were generated by site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, NEB), using specific primers containing the sgRNA 20-mer target sequence (split in half across the two primers) ...
-
bioRxiv - Genomics 2022Quote: Libraries for sequencing were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB E7645), as described by the manufacturer but using half volumes of all reagents and starting material ...
-
bioRxiv - Immunology 2022Quote: Plasmids containing templates for CRISPR-mediated KI were assembled using the NEBuilder HIFI assembly kit (New England Biolabs) starting from PCR amplified fragments ...
-
bioRxiv - Microbiology 2022Quote: DNA libraries were prepared with the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB, USA) according to the manufacturer’s protocol using ∼300 ng of DNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The K107E and K107T mutations were generated using the Q5 Site-Directed Mutagenesis Kit (E0552S, New England Biolabs) with primers listed in Supplemental Table 3 in pENTR/D-TOPO followed by transfer to pIX-HALO ...
-
Patient-associated mutations in Drosophila Alk perturb neuronal differentiation and promote survivalbioRxiv - Cancer Biology 2022Quote: ... the AlkY1355S HDR donor construct was modified accordingly using the Q5® site-directed mutagenesis kit (NEB, #E0554S). Due to the close proximity of both codons within the sequence ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing libraries were generated using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Cell Biology 2022Quote: ... then libraries were generated using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s recommendation ...
-
bioRxiv - Neuroscience 2021Quote: ... the cDNA libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (E7530S, New England Biolabs). Quality of the cDNA library was also assessed by Qubit assay for concentration ...
-
bioRxiv - Biochemistry 2021Quote: ... The E PBM C-terminal mutation (DVLL>GGGG) was performed using the Q5 site-directed mutagenesis kit (NEB). The sequences corresponding to the PDZ domains were cloned into the pCMV GFP vector using EcoRI and XhoI sites.
-
bioRxiv - Microbiology 2021Quote: ... The two amplicons were fused using a NEBuilder HiFi DNA Assembly kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription and qRT-PCR analysis was performed by Luna universal one- step qRT-PCR kit (NEB # E3005L) with primers list in Table 9.
-
ACE2-lentiviral transduction enables mouse SARS-CoV-2 infection and mapping of receptor interactionsbioRxiv - Microbiology 2021Quote: ... as was the pCDH vector before purification again with Monarch® DNA Gel Extraction Kit (New England Biolabs). The ACE2 fragment was ligated with pCDH vector using T4 DNA Ligase (New England Biolabs ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cDNA was generated by reverse transcription using the ProtoScript® II First Strand cDNA Synthesis Kit (NEB). cDNA was amplified with primers flanking each splice site by Taq polymerase (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were generated using NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina® (NEB, USA). PCR was performed with Phusion High-Fidelity DNA polymerase ...
-
bioRxiv - Molecular Biology 2020Quote: ... library preparation was completed using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs). The adapters and PCR primers used were purchased from New England BioLabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... strand-specific cDNA libraries were generated by NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... We constructed libraries from 300 ng of RNA using NEB Next Ultra RNA kit (New England Biolabs, USA) and isolated Poly(A ...
-
bioRxiv - Microbiology 2020Quote: ... Whole genome shotgun libraries were prepared using the NEB Ultra Library Prep kit (New England Biolabs; Ipswich, MA) for sequencing on either the MiSeq or HiSeq (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: Library preparation: TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... First strand cDNA was synthesised using a ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, E6560) using oligo d(T)23 primers and 500 ng total RNA.
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were prepared according to the “NEBNext Ultra Directional RNA Library Prep kit for Illumina” (New England Biolabs) instructions and sequenced using a “NextSeq™ 500 High Output Kit” ...
-
bioRxiv - Microbiology 2021Quote: ... and dual indexed libraries were prepared using the NEBNext Ultra Directional RNA sequencing kit (New England Biolabs, USA). Libraries were sequenced on a HiSeq 4000 (Illumina ...
-
bioRxiv - Biochemistry 2021Quote: The VoC RBD mutations were introduced by site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, New England Biolabs). Successful cloning was confirmed by Sanger sequencing (Genewiz ...
-
bioRxiv - Microbiology 2020Quote: Site-directed mutagenesis was performed using the Q5 site-directed mutagenesis kit according to the manufacturer’s instructions (NEB). All mutations were confirmed by DNA sequencing.
-
bioRxiv - Immunology 2020Quote: ... Restriction enzymes (BamHI-HF and NheI-HF) and Quick Ligation kit were purchased from New England Biolabs (NEB). Linker insertion and modifications in the antigen-bearing components were achieved using Q5 Site Directed Mutagenesis Kit (NEB) ...
-
bioRxiv - Immunology 2020Quote: ... Linker insertion and modifications in the antigen-bearing components were achieved using Q5 Site Directed Mutagenesis Kit (NEB). Custom DNA primers produced by Integrated DNA technologies (IDT) ...
-
bioRxiv - Cancer Biology 2020Quote: ... in vitro transcription with T7 polymerase was done by T7 high yield RNA systhesis kit (New England Biolabs). Purification of mRNA was done by Qiagen mini column ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA libraries were prepared using the NEB Next Ultra II Directional RNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA library was constructed according to the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, E7530) and NEBNext Multiplex Oligos for Illumina (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... Generation of the CK2K198R mutant was done using the Q5® Site-Directed Mutagenesis Kit (New England BioLabs).
-
bioRxiv - Microbiology 2021Quote: ... followed by library preparation with NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs). DNA library preparation included 6 cycles of PCR amplification ...
-
bioRxiv - Microbiology 2021Quote: ... Catalytically inactive Mt2 (Mt2 C78A) variant was generated via site-directed mutagenesis (NEB, Q5 Site-Directed Mutagenesis Kit) using primers listed in the primer table (Table S1).
-
bioRxiv - Biochemistry 2020Quote: ... The G163H (30) and G163D variants were constructed using the Q5 site-directed mutagenesis kit (New England Biolabs) to introduce the mutation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Strand-specific libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB). Libraries were sequenced by paired-end sequencing with a 75 (patient samples ...
-
bioRxiv - Neuroscience 2022Quote: ... sequencing libraries were generated using a NEBNext Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs) and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Neuroscience 2022Quote: ... One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England BioLabs) in a total volume of 20 µl and a template concentration of 50 ng/µl according to the manufacturer’s recommendations ...