Labshake search
Citations for New England Biolabs :
5951 - 6000 of 10000+ citations for Mouse Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... respectively) using T4 RNA Ligase 1 (New England Biolabs, USA; #M0204) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 µl of Golden Gate Enzyme Mix (BsaI-HFv2, NEB M2616AA), and adding dH2O to reach a total volume of 20 µl ...
-
bioRxiv - Microbiology 2024Quote: ... Ligation of 5’ linker using T4 RNA ligase 1 (NEB; #M0204S) was conducted after phosphorylating the 5’ end of the pooled fragments with T4 PNK (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by the addition of 1 μl M13KO7 helper phage (NEB).
-
bioRxiv - Cancer Biology 2024Quote: ... made up of 1 uL DNA Ladder (New England Biolabs, N3231L), 1 µL Purple Dye (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... 72 °C for 1 min) × 5] using NEBNext 2xMasterMix (NEB, M0541S) with Ad1_noMX and v2_Ad2.* indexing primers followed by qPCR amplification to determine additional cycle numbers ...
-
bioRxiv - Systems Biology 2024Quote: ... IVT products were treated with 1 U of DNase I (NEB) at 37°C for 15 min and brought to a final volume of 100 µL with nuclease-free water ...
-
bioRxiv - Microbiology 2024Quote: ... (b) Heat labile Shrimp Alkaline Phosphatase (rSAP) (1 µl) (NEB #M0371S) was used to remove terminal phosphates that could interfere with terminal extension by incubating in rCutSmart buffer (3.5 µl ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 μL of terminal transferase (20 units, NEB Catalog #M0315S) was added to the reaction with incubation at 37 °C for 1 h to block any pre-existing strand-break sites ...
-
bioRxiv - Molecular Biology 2024Quote: ... steps 1–3: GELase was replaced by β-agarase I (NEB). The reaction (1 U per plug ...
-
bioRxiv - Bioengineering 2024Quote: ... NEBNext Multiplex Oligos for Illumina (Index Primer Set 1) (NEB, 7335S) were used for the final PCR amplification ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 μL of terminal transferase (20 units, NEB Catalog # M0315S) was added to the reaction with incubation at 37 °C for 1 h to block any pre-existing strand-break sites ...
-
bioRxiv - Genetics 2023Quote: ... We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles, Tm 62 °C). We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles ...
-
bioRxiv - Microbiology 2020Quote: ... it was performed following the instructions of Luna Universal qPCR Master Mix Kit M3003E (New England BioLabs, USA). Samples of eyelids ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequencing libraries were generated using a NEBNext®UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunoprecipitated chromatin was used for NGS library preparation (NEBNext Ultra II DNA Library Prep Kit for Illumina, NEB). Libraries were sequenced at the Max Planck Institute of Immunology and Epigenetics using HiSeq 3000 (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA of all cell lines was isolated using Monarch Total RNA miniprep kits (#T2010S, New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... NGS libraries were prepared using the NEBnext Ultra II DNA library preparation kit for Illumina (New England Biolabs) according to manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2020Quote: Poly-A RNA sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... The ClbI C-terminal GFP fusion was constructed using the Gibson Assembly kit (New England Biolabs, MA, USA). Briefly ...
-
bioRxiv - Systems Biology 2020Quote: ... Prokaryotic DNA was enriched from the total hindgut DNA extract using NEBNext Microbiome DNA Enrichment Kit (NewEngland BioLabs). Following sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... sgRNA (XXXXXXXX for KPC1 or CGGCGGCGGGATGTTCGTGC for KPC2) were synthetized in vitro using EnGen sgRNA Synthesis kit (NEB) and purified using RNA clean and concentrator (Zymo Research) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The sequencing libraries were constructed with NEB NextR UltraTM DNA Library Prep Kit for Illumina (NEB, United States) following the manufacturer’s instructions and index codes were added ...
-
bioRxiv - Cell Biology 2020Quote: ... The FER1 Ca2+-binding mutants in the C2D domain were generated by Q5 site directed mutagenesis kit (NEB) using primers 4833/4834 to change positions A1622 and A1634 to C resulting in Asp codon 542 and 545 changes to Ala.
-
bioRxiv - Cell Biology 2020Quote: ... Single or double mutations were produced with the Q5® Site-directed Mutagenesis kit (New England Biolabs, UK) using the primers in Table 1.
-
bioRxiv - Cell Biology 2020Quote: ... and pFLOE1p:FLOE1ΔDUF-GFP were obtained by modifying pFLOE1p:FLOE1-GFP using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) with primers priDSdeletion-FWD/REV ...
-
bioRxiv - Developmental Biology 2021Quote: Libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, E7645), with adapters diluted 1:5 from the supplied concentration ...
-
bioRxiv - Genetics 2021Quote: ... and stranded RNA-seq libraries were prepared using random hexamer and NEB directional RNA library prep kit (NEB) and sequenced on the NovaSeq 6000 PE150.
-
bioRxiv - Microbiology 2021Quote: ... The final libraries were purified on 2% preparative agarose gel by Monarch DNA Gel Extraction kit (NEB, T1020L). The concentration of each library was measured by performing quantitative PCR (qPCR ...
-
bioRxiv - Genetics 2021Quote: ... libraries were prepared using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs), using the appropriate protocols for DNA samples of 50 ng (lower input ...
-
bioRxiv - Developmental Biology 2021Quote: ... SWS point mutation of G to A was generated using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with primers 5’-CATCCAGCGCaGGGTGACAAG-3’ and 5’-TCCTGGAAGGTGGTGGCA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... and subjected to Tru-seq library construction using NEBNext Ultra II DNA Library Prep kit (NEB, Cat E7645S) as standard protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Synthesized cDNA was subjected to library preparation with NEBNext Ultr II DNA Library Prep Kit (NEB, Cat E7645S). DNA was end-repaired ...
-
bioRxiv - Molecular Biology 2021Quote: ... The T718A substitution was created in pYES2-TOP1 using the Q5 site-directed mutagenesis kit (New England BioLabs) with primers 5’-TCGCCTGGGAGCCTCCAAACTCA-3’ and 5’- ATCTGTTTATTTTCCTCTCGGTCTGTG-3’.
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs Inc., Ipswich, MA, USA). Manufacturers’ instructions were followed for end repair ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sequencing libraries were made using the NebNext UltraII DNA kit for Illumina (New England Biolabs, Ipswich, Mass., USA), and PE150 sequencing conducted by Novogene (Beijing ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR products from all reactions were pooled and purified with the Monarch PCR & DNA Cleanup Kit (NEB) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Peptide constructs were assembled and integrated upstream of Venus using the NEBuilder HiFi Assembly kit (New England Biolabs). Correct assembly was verified by sequencing of inserts and flanking regions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Products from the first round PCR were then purified using Monarch DNA Gel Extraction Kit (New England Biolabs) and used as the templates for the second round insert PCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sequenced PCR products showing overlapping peaks in their chromatograms were cloned using NEB PCR cloning kit (NEB #E1202S) and then sequenced to define the identity of mutations carried by F1 heterozygous animals ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Libraries were prepared using the NEBNext® Ultra™ II FS DNA Library Preparation Kit (New England Biolabs) and the Unique Dual Indexing Kit (New England Biolabs) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Libraries were prepared using the NEBNext Ultra DNA Library Prep kit for Illumina (New England BioLabs, United States) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The DNA template was then in vitro transcribed using the HiScribe T7 high yield RNA synthesis kit (NEB) in a 20 μl reaction for 10 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Libraries were generated from the extracted RNA using the NEB Next RNA Library Prep kits (NEB, Ipswich, MA). Libraries were sequenced at the University of Massachusetts Genomics Core Facility on the NextSeq 500 with single end 75 base reads ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA libraries were prepared according to the protocol of the NEBNext Small RNA Library Prep Kit (NEB, #E7330). The mNET-seq library was obtained by PCR for 12 – 14 cycles.
-
bioRxiv - Molecular Biology 2020Quote: ... and then strand-specific library prep using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB E7760) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA-seq libraries were generated using NEBNext Ultra II directional RNA library Prep kit for Illumina (BioLabs, #E7765S) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sequences were obtained from libraries prepared using an NEB Ultra II Library Prep Kit (New England Biolabs # E7103), multiplexed and run on an Illumina MiSeq with a 150-cycle v3 Reagent Kit yielding approximately 7.6 million reads per sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... SSS reaction products (16 μL) were combined with 24 μL HiScribe T7 High Yield RNA Synthesis Kit (NEB) reagent mix containing 4 μL T7 Buffer ...