Labshake search
Citations for New England Biolabs :
5601 - 5650 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... 1 μL dNTP mix (NEB, 10 mM) and 2 µL 10x NEBuffer 3 (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL ENDOIV (NEB, 10 U/µL), 5 µL TAQ Ligase (NEB ...
-
bioRxiv - Genomics 2024Quote: ... comprised gDNA with 1 mM NAD+ (NEB), 1 µL dNTP mix (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL FPG (NEB, 8 U/µL), 1 µL ENDOIV (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 1 μL ligation enhancer (New England BioLabs), 0.9 μL nuclease-free water (Ambion ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and NP-40 (1% final; NEB, P0704S) with or without 1 µL/reaction of PNGase F (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL ENDOIV (NEB, 10 U/µL) and 3 µL 10x NEBuffer 2 (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL ENDOIV (NEB, 10 U/µL) and 1 µL T4 PNK (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... T4 RNA ligase 1 (30U/ul, NEB), water and PEG8000 (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing 1 volume of λ-Phosphatase (NEB) with 1 volume of water ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 U T4 RNA ligase 1 (NEB), 50 mM Tris-HCl pH=7.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL Dnp1 restriction enzyme (NEB, #R0176S) was added to the PCR mixture and the sample incubated at 37 °C for 1 h ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 µl of Dpn1 (New England Biolabs) was then added to the PCR product for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1 μl of HindIII (NEB R3104S) were added to an Eppendorf tube containing 2 μg of pUC19 plasmid at a total volume of 50 μl ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL T4 DNA Ligase Buffer (NEB), 0.5 µL T4 DNA Ligase (NEB) ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL of the appropriate buffer (NEB) and 0.125 µL of each restriction enzyme were combined in 10 µL total reaction volume ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 U/μL RNase Inhibitor (NEB) in Biotin Wash Buffer (10 mM Tris HCl pH 7.4 ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 μL of 10X T4 buffer (NEB), and 5 μL of nuclease-free water (Ambion ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 μL T4 ligase buffer (NEB, B0202S), 0.5 μL Esp3I (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 μL 10X rCutSmart buffer (NEB, B6004S), and H2O to 10 μL incubated at 37°C for 2 hours and 80°C for 1 hour) ...
-
bioRxiv - Bioengineering 2024Quote: ... and 1 μL Taq polymerase (NEB, M0267S) and incubation at 37°C for 20 min and 72°C for 5 min) ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 μL T4 ligase buffer (NEB, B0202S), 0.5 μL Esp3I (Thermo Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... and with 1 µL PmeI (NEB #R0560). If plasmid concentration was not sufficient ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL T4 DNA Ligase Buffer (NEB), and water to 10 µL was incubated at 37°C for 1 hour ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 1 U/µL murine RNAse inhibitor (NEB), 400 nM 11S NanoLuc protein (purified as described in25) ...
-
bioRxiv - Cell Biology 2022Quote: ... mixed with 10 μl of lysis buffer (10 mM Tris-HCl [pH 8.8], 1 mM EDTA, 25 mM NaCl, 1% SDS and 8U/ml Proteinase K, NEB) for 3 min at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... 50 ng of DNA was incubated for 1 hour at 60 °C with 1 U BstUI and 0.5 uL 10x CutSmart buffer (New England Biolabs), in a total volume of 5.0 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleavage fragments were resolved by 0.8% agarose gel electrophoresis with 1 μL of 1 kb Plus DNA Ladder (NEB) and visualized by ethidium bromide staining ...
-
bioRxiv - Microbiology 2020Quote: ... Beads were resuspended in 48 μL elution buffer (50 mM Tris pH 8, 1 mM EDTA, 1% SDS) and 1.6 U Proteinase K (NEB), incubated at 55 °C for one hour and then 65 °C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... while the ter region was amplified using the primer pair 3778_ter 1 qPCR fwd with 3778_ter 1 qPCR rev and the Luna Universal qPCR Master Mix (New England Biolabs). Quantification of the ori/ter ratio was performed using the the 2-ΔCT method as described [62].
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR products were inserted into pET28a using restriction digestion and ligation with EcoR 1 and Sal 1 (NEB) sites.
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Bioengineering 2022Quote: ... 1 µL of 1 µM Cas9 Nuclease (diluted from 20 µM stock in 1X NEBuffer r3.1) (NEB; catalog # M0386T), and 1X NEBuffer 3.1 (NEB ...
-
bioRxiv - Genomics 2024Quote: ... was utilized using 1 µg gDNA and the pre-annealed NEB adapter (NEB_P7, NEB_P5, 15 µM; Supplementary Table 1). The manufacturer’s instruction was followed without performing the USER enzyme step ...
-
bioRxiv - Genomics 2024Quote: ... beads were resuspended in 1 ml binding buffer (as described above) including 1 μl of fusion enzyme Nt.CviPII-pGL (NEB) for 1 hr at RT ...
-
bioRxiv - Bioengineering 2024Quote: ... were mixed in molar ratio 1:1 and 0.37 pmol of total DNA was then treated by Gibson Assembly Master Mix (New England Biolabs) for 3 hours at 50°C ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 8.0) for 1 h at 37 °C and washes in CSTX buffer (1× CutSmart buffer (New England Biolabs (NEB) B60004) ...
-
bioRxiv - Molecular Biology 2022Quote: ... A total of 1.5 μL of 100 μM the forward and reverse DNA oligos were annealed in 47 μL annealing buffer (5 μl NEB buffer 3.1 and 42 μL H2O) by 5 min incubation at 95 °C and slow cool down in the heating block overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... from 4 to 15 hours at 37 °C. For Circle-Seq of the CRISPR treatments and controls (Fig. 5) exonuclease T (New England Biolabs; 20 units per μg of DNA) was then added ...
-
bioRxiv - Cell Biology 2020Quote: ... Annealed handles were mixed with the purified 21 kb ARS1-DNA at a molar ratio of 15:1 and ligated with T4 DNA Ligase in 1 × T4 ligase buffer (both NEB) at 16 °C overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... then overnight at 25°C with another 100 μl of the same buffer containing 2.7 μl END-seq adaptor 1 and 1 μl high concentration T4 DNA Ligase (NEB M0202M). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Genomics 2020Quote: ... The crRNA and tracrRNA with Alt-R modification (Integrated DNA Technologies) were annealed in a 1:1 ratio to form gRNA that was used in the Cas9 (New England Biolabs) digestion of the SMRTbell libraries ...
-
bioRxiv - Immunology 2021Quote: ... one as Cytosolic Extraction Buffer (CEB) (HEPES 10 mM; KCl 60 mM; EDTA 1 mM; NP40 1%) and another one as Nuclear Extraction Buffer (NEB) (HEPES 20 mM ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was cloned into NdeI-SapI site of the expression vector pTXB-1 (Table 1, New England Biolabs) with a C-terminally tagged chitin binding domain (CBD ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μL of previously assembled Cas9-RNP complex was added together with 1 μL of dATP (10 mM) and 1 μL of Taq polymerase (NEB) and incubated at 37ºC for 20 minutes and at 72ºC for five minutes for A-tailing ...
-
bioRxiv - Molecular Biology 2022Quote: ... The L5 RNA linker at 1 μM concentration (Table S1) was ligated to RNA in a 20 μl reaction using by 1 U/ μl of RNA Ligase 1 (NEB) in the presence of 15% PEG8000 ...