Labshake search
Citations for New England Biolabs :
501 - 550 of 3589 citations for Recombinant Mouse Scavenger Receptor Class B Member 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... The gene fragments were individually cloned into sensor plasmid backbones identical to those used in the previous identification of non-functional TetR(B) mutants following the manufacturers protocol for Gibson Assembly (New England Biolabs). The newly constructed plasmids carrying each of the combined mutants were then transformed into E ...
-
bioRxiv - Genetics 2021Quote: ... and assembly of the recombinant vector was performed with the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich, MA, USA). To generate the double ΔnoxA Δyap1 knockout mutant ...
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Histone yields from each purification were determined by using a calibration curve of recombinant H3 and H4 (NEB, cat. #M2503S, #M2504S, respectively). Absolute amounts of histone were determined by densitometry on coomassie-stained bands with Fiji61 for Pristionchus data (conducted at the MPI in Tübingen ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Biochemistry 2020Quote: GQES7-a and GQES7-b were synthesized in vitro by transcription (HiScribe™ T7 High Yield RNA Synthesis Kit; New England Biolabs). GQes3 and mutes3 ...
-
bioRxiv - Genomics 2021Quote: ... TF motif libraries in pGL4.10-Sasaki-SS (a) and pCpG-free-EF1α-SS (b) vectors were amplified using standard Illumina Universal and index primers (NEB #E7335S) and sequenced using standard Illumina chemistry ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... (fhuA2 [lon] ompT gal (lambda DE3) [dcm] ΔhsdSlambda DE3 = lambda sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5) (New England Biolabs, C2527I) were used ...
-
bioRxiv - Microbiology 2020Quote: ... with rotation for 1 hour at room temperature followed by further incubation for 1 hour with the addition of 15 μl of goat anti-mouse IgG magnetic beads (New England Biolabs, Ipswich, MA, USA). The magnetic beads in the supernatant were collected on a magnetic stand and washed 2 times with PBS ...
-
bioRxiv - Genetics 2024Quote: ... The B splice form (Spc105RB) was generated using site directed mutagenesis to delete the first intron from the A form (NEB BaseChanger Kit). All mutants were generated using site specific mutagenesis of the A- or B-form Spc105R coding region in the pENTR4 vector ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-MBP (New England Biolabs, RRID:AB_ 1559738), used at 1:5000 ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the C-terminus of clpP1 were amplified by PCR using the A–B and C–D primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs, Ipswich, United States). For clpP2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... mouse monoclonal anti Pan-Keratin (clone C11, NEB, 4545S). Primary antibodies were incubated with sections overnight at 4°C except for anti-CD3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... mouse monoclonal antibodies against PAR (clone 10H, Tulip BioLabs, USA), anti-mouse antibodies conjugated with horseradish peroxidase (Bio-Rad ...
-
bioRxiv - Genetics 2024Quote: ... and mid-range PFG ladder (for mouse samples) (NEB Inc.) and 1 kb ladder (GeneDirex Inc.) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Maltose Binding Protein monoclonal antibody IgG2a (New England Biolabs), mouse anti-Histone H3 [Trimethyl Lys9] 6F12-H4 (Novus Biologicals) ...
-
bioRxiv - Cell Biology 2024Quote: ... was amplified from mouse cDNA by polymerase chain reaction (NEB, M0492L) using primers below:
-
bioRxiv - Molecular Biology 2020Quote: ... antibody were incubated with 25 µL of magnetic anti-mouse beads (NEB) overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H3 (Lys 23) mouse mAb (PTM Biolabs, SKU: PTM 307), Butyryl-Histone H4 (Lys 8 ...
-
bioRxiv - Genomics 2020Quote: Mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA), and XP12 phage DNA was obtained from Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Genomics 2019Quote: ... mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA, USA). E14 genomic DNA was extracted with a DNeasy Blood and Tissue Kit (QIAGEN ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-mouse IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) were used as the secondary antibodies.
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Developmental Biology 2023Quote: Regulatory elements were amplified from mouse genomic DNA with Q5 polymerase (NEB, M0491) using primers listed in Table S8 and cloned into pGL4.24[luc2P/minP] (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids encoding mouse Nav1.2 (NP_001092768.1) and Nav1.6 (NP_001070967.1) were cloned by Gibson Assembly (NEB) with synthetic gBlocks gene fragments (Integrated DNA Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: Mouse phogrin was obtained from the IMAGE consortium (clone BC_133678) and CLIPf from NEB. The fusion protein was generated by standard molecular cloning techniques ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse Adnp was amplified from pENTR223.1-Adnp using Q5 High Fidelity DNA Polymerase (NEB) and primers containing 6xHis tag to insert it into the C-terminal region of Adnp ...
-
bioRxiv - Genomics 2022Quote: ... 1 μl of Exonuclease 1 (NEB, M0293S) was added to each PCR product and incubated at 37C for 15 min to digest any single-stranded product ...
-
bioRxiv - Molecular Biology 2024Quote: ... in 1× NEB buffer 1 (NEB, B7001S) for 15 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% cholorophorm was added together with 10 μg mL-1 DNase 1 (NEB) and 1 μg mL-1 RNase A ...
-
bioRxiv - Molecular Biology 2021Quote: ... depleted with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat, NEB, Figures 6 and S6), or not depleted (Figures 2B ...
-
bioRxiv - Genomics 2022Quote: For each of the two ligation-based protocols used for mouse sperm (Truseq, NEB Next), two replicate libraries for mouse sperm were prepared with the additional condition of an 18 hour ligation at 16°C for the ligation of the 3’ adapter in the attempt to increase ligation efficiency ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat; NEB, E6310X). rRNA-depleted RNA was converted to a library using NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Microbiology 2022Quote: The recombinant constructs (pETDuet-1-TaPHB-1 and pETDuet-1-TaPHB-1-RUVBL1 were separately transformed into E. coli Lemo21(DE3) (NEB) chemical competent cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated ddRTP molecules were inactivated by adding 1 µL of Buffer 2 (80 mM MgCl2) and 1 µL of 1:1 rSAP (NEB):50% glycerol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM MgCl2) supplemented with 1 mM ATP and 1 U/μL RNase Inhibitor (NEB). Reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Clean RNA was first rRNA depleted using the NEBNext rRNA depletion kit (Human/Mouse/Rat) (NEB) before being prepared for sequencing using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) according to the manufacturer’s instructions with 6 µl total RNA used as input per sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the NEBNext rRNA Depletion Kit v2 (Human/ mouse) (NEB #E7405), NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760 ...
-
bioRxiv - Immunology 2023Quote: ... for mouse was PCR-amplified and ligated into this vector via Gibson assembly (NEB, Cat# E2621S). The ligated product was precipitated ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 unit µL-1 EcoRI-HF (New England Biolabs)) ...
-
bioRxiv - Biophysics 2020Quote: ... 1 U μL−1 murine RNase inhibitor (NEB, M0314L), 600 ng mRNA and 50 μM PF846 in 1% DMSO ...
-
bioRxiv - Genomics 2021Quote: ... 1 unit/μl RNA ligase 1 (New England Biolabs), 1× RNA ligase buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 U.μL-1 of murine RNase Inhibitor (NEB M0314), 500 μM of rNTPs (NEB ...