Labshake search
Citations for New England Biolabs :
451 - 500 of 3589 citations for Recombinant Mouse Scavenger Receptor Class B Member 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Immunology 2020Quote: ... was inserted into a published oligonucleotide scaffold (Talbot and Amacher, 2014) and injected together with recombinant Cas9 protein (New England Biolabs) into 1-2 cell stage zebrafish (AB strain) ...
-
bioRxiv - Microbiology 2020Quote: Template DNA was amplified by PCR using custom DNA primers (Table S3) and recombinant Phusion Hot Start polymerase (New England Biolabs). In vitro transcription was carried out in a volume of 2.5 mL comprising 1.0 mL of PCR reaction as template ...
-
bioRxiv - Genomics 2021Quote: 1 µg of genomic DNA (nuclear + mitochondrial DNA) per 50 µl reactions was digested with 40 units of the recombinant restriction enzyme BamHI-HF (NEB) for 1 hour at 37°C in the presence of CutSmart buffer (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... All the point mutations in the recombinant LC3B and GABARAP were generated by Q5 Site-Directed Mutagenesis Kit (New England BioLabs). pGEX-6P1-GST-ATG3 was a gift from Dr ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... coli C2523 pMAL-c5X vector and recombinant MUP (rMUP) was made using pMAL Protein Fusion and Purification System (New England Biolabs) using methods similar to prior studies27,36 ...
-
bioRxiv - Molecular Biology 2019Quote: 100µM of the synthesized phosphopeptides (Aapptec) or non-phosphorylated peptides were incubated with 350units of recombinant GSK3β (New England Biolabs) and cold kinase buffer ...
-
bioRxiv - Molecular Biology 2019Quote: 10 pmol of either RNA I or RNA A was incubated in the presence or absence of both Mg2+ at a 10 mM final concentration and/or 9pmol recombinant eEndoV (New England Biolabs) in a total volume of 10 μL ...
-
bioRxiv - Developmental Biology 2019Quote: ... The recombinant DBINO domain containing protein (~80kDa) was purified using the amylose affinity column (New England Biolabs, Massachusetts, United States) and detected using the anti-MBP-HRP antibody (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein expression was induced with 0.3 mM IPTG for 2 hours at 37°C and recombinant MBP-rabaptin5 was purified with an amylose resin (New England Biolabs) according to manufacturs instructions and dialysed against lysis buffer (20 mM Tris-HCl ph7.4 ...
-
bioRxiv - Microbiology 2022Quote: ... The linearized vector and geneblock were then mixed to create the dsTE12Q.HA-Capsid recombinant SINV vector using NEBuilder® HiFi DNA Assembly Master Mix per manufacturer’s instructions (New England BioLabs, E2621S). The mutant herpes simplex virus type 1 (HSV-1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ triphosphates on the synthesis products were converted into 5’ monophosphates: samples were treated with recombinant shrimp alkaline phosphatase (NEB) (10 µl reaction in 1× NEB buffer 2.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A CRISPR array containing two repeats and one spacer targeting the gfp gene of recombinant Sindbis virus (SINV-GFP) was generated by annealing and extending two partially complementary DNA oligos with Q5 polymerase (NEB) (Table S1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... When needed the mRNA was polyadenylated after transcription using a recombinant poly-A polymerase as recommended by the manufacturer (NEB Biolabs).
-
bioRxiv - Cell Biology 2022Quote: Recombinant human ADAMTSL2 constructs where generated by PCR-amplification with the Q5 Hot start high fidelity 2x master mix (NEB) and specific primer pairs to allow for restriction cloning ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1× CutSmart buffer (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, 100 µg/ml BSA or recombinant albumin; NEB), 0.5 mM 1,4-Dithiothreitol (DTT) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 200 μM each of dATP/dCTP/dTTP at 21°C for 10 min and an additional 15 min incubation with 25 nM recombinant human RPA (a gift from Sarah W. Cai) and 0.03 U/μl T4 DNA polymerase (NEB, #M0203) at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... dsRNA was synthesized from T7-linked DNA using the HI Scribe™ T7 High Yield RNA Synthesis Kit (New England, Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... DOM-A and DOM-B K945G mutants were generated by site-directed mutagenesis (New England Biolabs, Cat. No E0554S). For transfection in Drosophila cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was sheared by incubating the nuclei in 100 µl of buffer B supplemented with 1,000 units of micrococcal nuclease (M0247S; NEB) for 30 min at 37°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 8 μL of solution A and 6 μL of solution B were mixed with 16 U RNase Inhibitor (NEB), gBlock templates (2 nM each ...
-
bioRxiv - Genomics 2023Quote: ... Then equal amounts of purified linear A and B PCR products were mixed with the Taq DNA ligase (NEB) and its buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplified PCR products were ligated into the recombinant plasmid pZE0-P-MglE-T using the recommended standard USER cloning protocol (NEB, UK).
-
bioRxiv - Developmental Biology 2021Quote: ... After annealing the complex an equimolar amount was mixed with 1000 ng Cas9 recombinant protein (NEB; final concentration 20 ng/μL) and incubated at RT for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: Phase separation of purified recombinant Cdc15-IDR-SH3 co-expressed with Pom1 was induced by treatment with α-phosphatase (NEB; P0753L) and dilution to physiological salt concentrations (50 mM Tris pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: The antibody expression vectors for each recombinant antibody (VH + VL-L/k) were transfected together with a Transposase vector (Hera BioLabs, USA). Cells were selected with Hygromycin B (H3274 ...
-
bioRxiv - Neuroscience 2022Quote: All anti-tau monoclonal antibodies were generated by the hybridoma approach against recombinant tau aggregates (human full-length tau) encapsulated in the ACM Polymersomes (ACM Biolabs, Singapore) and purified by size exclusion chromatography (SEC ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant cohesinWT or cohesin3D (25 nM) were incubated with 50 nM NIPBL-MAU2 and 10 ng/μl λ-DNA (NEB, N3011S) in ATP reaction buffer consisting of 20 mM NaH2PO4/Na2HPO4 pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... When needed the mRNA was polyadenylated after transcription using a recombinant poly-A polymerase as recommended by the manufacturer (NEB Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: ... Unligated 3’ linker was removed by incubating the samples with the 5’-deadenylase KmHnt3 (see Recombinant protein expression and purification) and RecJ exonuclease (New England Biolabs, M0264S) for 45 min at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... All recombinant plasmids in this study were constructed with NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs, Ipswich, Massachusetts, USA). All oligonucleotides were ordered and all sequencing works were done at Eurofins Genomics (Ebersberg ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-MBP (NEB, E8032). Peroxidase and Alexa-fluor conjugated secondary antibodies were purchased from Jackson Laboratories and ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-myc (New England Biolabs), rabbit polyclonal anti- GFP (gift from Oliver Gruss ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA was amplified with 12 cycles of PCR using the NebNext Hi-Fi 2X PCR Master Mix (New England Biolabs Inc, Ipswich, MA, Cat #M0541S). Following PCR ...
-
bioRxiv - Genomics 2019Quote: ... were ligated onto Hi-C ligation products bound to streptavidin beads for 2 hours at room temperature (T4 DNA ligase NEB, in ligation buffer, slowly rotating). After washing twice with wash buffer (5 mM Tris ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... The reaction was performed in temperature cycles of 37°C for 2 min and 16°C for 5 min using the restriction enzyme Bsa I-HF® V2 and the Hi-T4™ DNA ligase (from New England Biolabs; Bioconcept, Allschwil, Switzerland), followed by a final 10 min ligation at 16°C ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were expressed as N-terminal His6-Smt3 fusion constructs from either pET28-b vectors (expressed in T7 Express lysY/Iq (NEB) Escherichia coli (E ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the clpP2 gene were amplified by PCR using the A–B and C–D primer pairs from table 3 (Phusion polymerase, GC buffer, New England Biolabs). The PCR products were purified with E.Z.N.A ...
-
bioRxiv - Biochemistry 2021Quote: ... 700 bp upstream and downstream were amplified using the A–B and C–CD primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs). The 2×myc tag was added to the B primers as overhangs ...
-
bioRxiv - Immunology 2022Quote: ... ligated in EcoRI-digested pCCLc-MND-X (A kind gift from Dr. Donald B. Kohn) and transformed using NEB-5alpha cells (NEB). Inserts were verified using MND_Input_Verify_F and MND_Input_Verify_R ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from IgG1 stimulated B cells 72 hour post-stimulation using TRIzol reagent (Fisher) and cDNA was prepared using the Protoscript II kit (NEB). Germline transcription was analyzed using quantitative PCR with SYBR Green (Roche ...
-
bioRxiv - Immunology 2022Quote: ... and Illumina linker addition to B cell heavy chain transcripts were performed using the human NEBNext Immune Sequencing Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The entry module pGG-B-AtU6-26-BRI1-2-C and pGG-A-AtU6-26-BRI1-3-B were generated by annealing oligos for each gRNA and ligating into BbsI-digested (New England Biolabs) Golden Gate entry vectors described in (66) ...
-
bioRxiv - Microbiology 2023Quote: ... and a 1848 bp fragment (containing the 1131 bp Pfcytb open reading frame) was amplified with primers (SI Appendix, Fig. S2A,B) and Phusion DNA polymerase (NEB). PCR product was verified by gel electrophoresis as single band of predicted size ...
-
bioRxiv - Microbiology 2023Quote: ... These PCRs were performed with the specified primer sets (a, c and e or b, d and f) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Type I-F Cascade was co-expressed with 6xHis-MBP-TEV-TniQ and a type III-B crRNA in NiCo21 cells (NEB). Cells were then induced with 0.5 mM isopropyl at 18 °C for another 18–20 hours before harvesting ...
-
bioRxiv - Neuroscience 2024Quote: ... a V5 tag was inserted after the start codon of Ten-m cDNA (isoform B) in the plasmid pUAST-attB-Ten-m5 using the Q5 site-directed mutagenesis kit (New England Biolabs). To generate the UAS-V5-Ten-m-ΔICD and UAS-V5-Ten-m-ΔECD constructs ...