Labshake search
Citations for New England Biolabs :
501 - 550 of 4584 citations for 6 CHLORO 2 THIOPHEN 2 YL IMIDAZO 1 2 A PYRIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 2’-O-methylations were also detected by RNase H (NEB, M0297S) digestion of 2 μg with 25 pmol chimeric RNA-DNA probes ...
-
bioRxiv - Genomics 2023Quote: ... DNA was pre-amplified with 2× NEBNext Master Mix (NEB M0541S). Library amplification was assessed by qPCR on Applied Biosystems QuantStudio 3 real-time PCR system ...
-
bioRxiv - Molecular Biology 2023Quote: ... or RNase A (2 µg, Monarch RNase A; New England Biolabs) and incubating for another 15 min at 25°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were PCR-amplified (12.5 μL NEBNext High-Fidelity 2× NEB PCR Master Mix ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Genetics 2023Quote: ... 5μL of 2× Luna Universal qPCR Master Mix (NEB, MA, USA). The amplification program was set as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μL of 10x DNase I Buffer (New England Biolabs, #m0303s), 1 μL of rDNase I (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... 0.25 μM of adapter and 2 μL of Quick ligase (NEB) for 20 minutes at 23°C in 40 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl Hot Start High-Fidelity 2× Master Mix (M0494S; NEB) and nuclease-free water to fill up to 10 μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... For nucleosomes labeling reaction mix contained: NEBuffer™ 2 (NEB B7202), protease and HDAC inhibitors (as detailed above) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl Klenow enzyme (5 units/µl, New England Biolabs, M0210S), and 3 µl 10 mM dNTP (KAPA HiFi Kits from Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 µL NEBNext HiFi 2× PCR Master Mix (New England BioLabs) was added to the DNA mixture ...
-
bioRxiv - Genomics 2023Quote: ... a hybridization reaction was carried out in 1X Buffer 2 (NEB). 10 µM pool of designed oligomers and 10 µM of a complementary-overlap-containing-oligomer were first denatured at 95°C for 15 seconds and allowed to hybridize at 43°C for 5min ...
-
bioRxiv - Genomics 2023Quote: ... 0.3 μg DNA was digested with 2 U DpnI (NEB R0176S) or 5 U MboI (NEB R0147S ...
-
bioRxiv - Molecular Biology 2024Quote: ... cell lysates were first incubated with Deglycosylation Mix Buffer 2 (NEB) at 75°C for 10 min ...
-
bioRxiv - Genomics 2024Quote: ... A-tailing was done with 1X NEBuffer 2 (New England Biolabs), 0.2 mM dATP ...
-
bioRxiv - Genomics 2024Quote: ... 2.5 μl of DTT and 2 μl of Blunting Enzyme (NEB) in a total reaction volume of 50 μl ...
-
bioRxiv - Genomics 2024Quote: ... the reaction is treated with 2 μl of Proteinase K (NEB). The digestion is carried on at 37°C for 30 minutes ...
-
bioRxiv - Genomics 2024Quote: ... 20 µL of 2% BSA (New England Biolabs, catalog no. B9000S), and 1.86 mL of nuclease-free water ...
-
bioRxiv - Immunology 2024Quote: ... and 2 µg/µL of Proteinase K (New England Biolabs, #P8107S), was prepared and loaded into a 3 mL syringe (BD Biosciences ...
-
bioRxiv - Microbiology 2024Quote: ... 2 mM DTT) and a wash with 10 μL streptavidin (NEB). The chamber was further washed with 10 μL TIRF buffer followed by a 1-minute incubation with 2 μL of microtubules diluted in 8 μL TIRF buffer supplemented with 50 mM KCl and 1.25 mg/mL casein (TIRF-Casein) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were ligated to barcode primers 1-20 of NEBNext Index Primers for Illumina sets 1 and 2 (New England Biolabs) and libraries analysed using DNA High Sensitivity chip on an Agilent 2100 Bioanalyzer before being pooled ...
-
bioRxiv - Biophysics 2023Quote: ... and a reverse elongation primer (Supplementary Tables 1 and 2) and incubating for 1 cycle of annealing/extension with Q5 polymerase (New England Biolabs). dsDNA product was then incubated with ExoSAP-IT (Applied Biosystem ...
-
bioRxiv - Bioengineering 2024Quote: ... containing 0.06 % pluronic acid (F-127, final concentration) and 1 µL of each disulfide bond enhancer 1 and 2 (NEB #E6820). We used droplet oil consisting of 3M™ Novec™ HFE7500 Engineered Fluid (3M ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 ng of PCR product of RFLP_region 1 and RFLP_region 2 were digested with PstI (New England Biolabs) and VspI (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... at 30°C for 1 hour in a total volume of 50μl PMP phosphatase buffer (50 mM HEPES pH 7.5, 100 mM NaCl, 2 mM DTT, 0.01% Brij 35, 1 mM MnCl2; New England Biolabs).
-
bioRxiv - Biochemistry 2020Quote: ... by incubating the cells with 2 μM ATTO594-Coenzyme A and 1 μM phosphopantetheine transferase (New England Biolabs) in Ham’s F12 medium without FBS at ~25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... A 32P radiolabelled Y’ PCR fragment (oligo sequences in Supplementary Table 1) or 2-log ladder (NEB N3200L) was added at 106 counts/ml of Y’ and 104 counts/ml of 2-log ladder and hybridized overnight ...
-
bioRxiv - Microbiology 2022Quote: ... region between MCS-1/MCS-2 and linearized pETDuet plasmid were ligated using the Gibson Assembly® (NEB) to generate the pETDuet pe15/ppe20 plasmid ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and assembled into the backbone vector at a 2:1 molar ratio via Golden Gate Assembly81 (NEB #R3733). The assembly mix was then transformed into electrocompetent DH10B E ...
-
bioRxiv - Immunology 2020Quote: ... 1 mM ATP and 3 units of T4 DNA ligase for 2 h at RT (all from NEB). Next ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µL of each reaction was combined with 2 µL of 6X Purple Gel Loading Dye (NEB B7024S) and 11 µL H2O and run on a 1.2% agarose gel containing 1X GelGreen Nucleic Acid Stain (Biotium 41005 ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μl of methylation-sensitive restriction enzyme DpnI and 2 μl CutSmart® buffer (both from NEB inc.) were added to the assembled reaction and incubated at 37 °C for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: We then set up the digestion reaction (1.5 μg of pX459, 2 μL of 10X NEBuffer 2.1, 1 μL of BbsI (NEB), and added H2O to a final volume of 20 μL) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM NaCl, 2 mM EDTA, 1% NP40, 0.1%SDS, 0.5 mM DTT, 40 U RNase inhibitor [New England Biolabs, cat#M0314L] ...
-
bioRxiv - Bioengineering 2024Quote: ... DNA fragments encoding CDRs 1 and 2 were digested overnight with BsaI-HFv2 and BbsI-HFv2 respectively (NEB). Reactions were cleaned up with Macherey Nagel Gel cleanup columns ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in 1 volume of buffer A / 300 mM NaCl / 2 mM MnCl2 / 1 mM DTT and incubated with λ protein phosphatase (NEB) at 50 U / mL for 1 hour at 23°C with agitation ...
-
bioRxiv - Systems Biology 2019Quote: ... the Nickel-NTA beads were incubated in 80 μl 3’-linker ligation mix with (1 X PNK buffer, 1 µM 3’-adapter, 10% PEG8000, 30U Truncated T4 RNA ligase 2 K227Q (NEB, M0351L), 60U RNasin) ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... RT-PCR or qPCR was performed with 1 μl of 1:2 diluted cDNA using the Q5®Hot Start High-Fidelity 2X Master Mix (NEB) or the SYBR™ Green PCR Master Mix (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mU of phosphodiesterase II from Sigma (# P9041-10 UN) and 2 U of alkaline phosphatase from Biolabs (# M0290) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl of 1.5 μM NEBNext adaptors for Illumina sequencing (NEB): 5’-phos-GATCGGAAGAGCAC-ACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3’ and 5’-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/AC-ACTCTTTCCTACACGACGCTCTTCCGATC*C-3’ (* ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.25 μL of Phusion Hot Start DNA polymerase (2 unit/μL; NEB), 5 μL of 5x Phusion buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... Agarose was subsequently degraded by adding 2 μl of β-agarase (Biolabs). To stretch DNA fibers ...
-
bioRxiv - Genomics 2019Quote: ... 2 µg of DNA were digested for 4 hours with MmeI (NEB) following the manufacturer’s instructions ...