Labshake search
Citations for New England Biolabs :
5401 - 5450 of 9715 citations for Human Transcription factor HIVEP2 HIVEP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and the sequencing libraries were synthesized using a NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB). Sequencing was performed using a NextSeq 500 Sequencer (Illumina ...
-
bioRxiv - Developmental Biology 2022Quote: ... and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1, NEB, E7335L). Conditions for PCR used are as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1, NEB, E7335L). Conditions for PCR used are as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs) size selection ...
-
bioRxiv - Genetics 2022Quote: ... The RNA was transcribed using 1ug of template with the HiScribe T7 Quick High Yield kit (NEB, E2050) according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were generated using the NEBNext Ultra II Directional Library Prep Kit (New England Biolabs, Ipswich, MA, USA) and subjected to sequencing (single-end 92× ...
-
bioRxiv - Genomics 2022Quote: ... Short-read sequencing libraries were constructed using NEBNext Ultra II DNA Library Prep kit for Illumina (NEB, USA) at the University of Melbourne ...
-
bioRxiv - Immunology 2022Quote: ... parkeri- infected ticks using the NEBNext Ultra™ RNA library Prep Kit (New England Biolabs, Ipswich, MA, USA). RNA library preparation and sequencing were conducted by Novogene Co. ...
-
bioRxiv - Genomics 2022Quote: ... 300 bp and 500 bp) were prepared using the NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) according to the standard protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The amplified fragment was cloned into pSEVA121 using the NEBuilder® HiFi DNA Assembly kit (New England BioLabs) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... quantified using the NEBNext Ultra RNA Library Prep Kit for Illumina (Cat No. 7530, New England Biolabs (NEB)) ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... Barcoded libraries were made with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Libraries were pooled and sequenced (single-end 75 bp reads ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA libraries were generated using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, cat# E7103S) according to the manufacturer’s instructions with the following modification for bisulfite treatment ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Microbiology 2022Quote: ... The libraries for sequencing were constructed using the NEB Next Ultra RNA Library Prep Kit for Illumina (NEB). The poly (A)-tailed mRNA was enriched using the NEB Next Poly (A ...
-
bioRxiv - Microbiology 2022Quote: ... sequencing libraries were generated using the NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) with 1 μg of total RNAs ...
-
bioRxiv - Microbiology 2022Quote: ... and RNA-Seq libraries were generated using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB # E7760L). Two biological replicates were sequenced using the Illumina NextSeq 550 platform to generate 150 bp PE reads ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesis was conducted via ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich MA, USA), using manufacturer’s instructions for reverse transcription of total RNA ...
-
bioRxiv - Systems Biology 2022Quote: ... The libraries were indexed with NEBNext Multiplex Oligos kit for Illumina (96 Index Primers, New England Biolabs, USA). Size distribution for the libraries and their quality were assessed using a high-sensitivity DNA chip (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extracted RNA from light and heavy fractions were subjected to qRT-PCR using Luna RT-qPCR kit (NEB).
-
bioRxiv - Plant Biology 2022Quote: ... ChIPseq libraries were prepared by NEBNEXT® UltraTM II DNA Library Prep Kit for Illumina (New England Biolabs) and sequenced using NovaSeq 6000 system (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... and a single band of the expected size was purified using Monarch Gel Extraction Kit (New England Biolabs). Purified amplicons from 6 Cas9-only control injected larva and from 24 gRNA-injected (and imaged ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and cloned into XbaI site of the pLS-mP-luc using NEBuilder HiFi DNA Assembly Cloning Kit (NEB). Fragments that failed to clone (human 2xHAR.11 ...
-
bioRxiv - Zoology 2023Quote: ... sequencing libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit (New England BioLabs, Frankfurt, Germany) according to the manufacturer’s instructions without prior fragmentation ...
-
bioRxiv - Neuroscience 2022Quote: ... Sequencing libraries were generated using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted using the Monarch® HMW DNA Extraction Kit (New England Biolabs, T3050S and T3060S) using manufacture’s protocol for iPSC samples ...
-
bioRxiv - Neuroscience 2022Quote: ... Complementary DNA (cDNA) was synthesized from 200ng RNA using LunaScript® RT-SuperMix kit (New England Biolabs #E3010). RT-qPCR reactions were performed using Luna® Universal qPCR Master Mix (New England Biolabs #M3003) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Y350A mutations of WW domains in Yki were generated by Q5 Site-Directed Mutagenesis Kit (NEB, Cat# E0554S) using pMT-yki-HA as a template ...
-
bioRxiv - Genomics 2022Quote: ... The purified product was then in vitro transcribed using “HiScribe T7 High yield RNA Synthesis Kit (NEB, E2040S) and purified using Monarch RNA Cleanup Kit (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... histolytica RNA was prepared using the Monarch Total RNA Miniprep Kit (NEW ENGLAND BioLabs, Ornat, Nes Ziona, Israel). According to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Sequencing libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... and RNAseq libraries were prepared using the NEB Ultra II Directional RNA library Prep kit (New England Biolabs), with 1 ug total RNA input and initial poly(A ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 uL of Quick Ligation Buffer and 5 uL of Quick T4 Ligase (NEB Quick Ligation Kit, M2200S). The ligation reaction was incubated for 10 minutes at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... viral cDNA was synthesized from the extracted RNA by using a LunarScript RT SuperMix Kit (New England BioLabs). The DNA was then amplified by performing a multiplexed PCR in two pools using the ARTIC-N5 primers and the Q5 Hot Start DNA polymerase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instruction and further purified using a Monarch® RNA Cleanup Kit (50 μg) (NEB). RNA integrity was monitored with agarose gels ...
-
bioRxiv - Microbiology 2022Quote: ... A sequencing library was generated using the NEB Next® Ultra™ DNA Library Prep Kit (NEB, USA) following the manufacturer’s recommendations and index codes were added to each sample ...
-
bioRxiv - Bioengineering 2023Quote: ... Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, US-CA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Systems Biology 2024Quote: ... 400 ng RNA were used as input for NEBNext Ultra RNA Library Prep Kit (New England Biolabs, USA). One sample (nonlesional skin of Pat1 ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA-Seq libraries were prepared by NebNext Ultra II RNA library preparation kit (New England Biolabs, Massachusetts, USA) and sequenced using Illumina’s state-of-the-art NovaSeq 6000 V1.5 platform (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sequencing libraries were completed with the “NEBNext Ultra II FS DNA Library Prep Kit for Illumina” (NEB #E7805) and subsequently analysed on an Illumina instrument by following manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2023Quote: ... column purified and ligated at a 1:1 vector to insert ratio using the QuickLig Kit (NEB #M2200S). The ASCL1 stop codon was subsequently mutated using the QuickChange II-XL site-directed mutagenesis kit (Agilent #200523 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The sequencing libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB Catalog# E7645S) following manufacturer instructions.
-
bioRxiv - Cell Biology 2024Quote: ... RNA-seq libraries were prepared using NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB). Pooled libraries were sequenced with paired end sequencing on a Novoseq 6000 by Novogene.
-
bioRxiv - Synthetic Biology 2024Quote: ... and PCR products were purified with Monarch PCR and DNA Cleanup kit (New England Biolabs, Ipswich, Massachusetts, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... Library preparation was performed using the NEBNext Ultra II Library Prep Kit for Illumina (New England BioLabs, #E7645S) per manufacturer’s instructions with minor modifications ...
-
bioRxiv - Zoology 2024Quote: ... PCR products were purified with a Monarch PCR & DNA clean-up kit (New England Biolabs, Whitby, ON, Canada) and used as template to reamplify the products to incorporate a Kozak translation initiation sequence prior to the start codon (Kozak ...
-
bioRxiv - Physiology 2024Quote: RNA libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, E7760) according to manufacturer’s polyA mRNA workflow at the Advanced Analysis Center at the University of Guelph (Guelph ...
-
bioRxiv - Neuroscience 2024Quote: ... CUT&RUN libraries were made using the NEB Ultra II DNA Library Prep Kit for Illumina (NEB E7645L), and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Microbiology 2024Quote: ... non incorporated primers were removed using the Monarch PCR and DNA clean up kit (New England Biolabs, T1030), using a binding buffer ratio to DNA of 3:1 ...