Labshake search
Citations for New England Biolabs :
5151 - 5200 of 9715 citations for Human Transcription factor HIVEP2 HIVEP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: DNA fragments from three libraries were prepared with NEBNext Ultra DNA Library Prep Kit for Illumina (NEB, USA), pooled together and sequenced on the Illumina HiSeq 2500 platform (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... the lexA-halo allele was amplified from SU225 and inserted into plasmid pBAD24 using Gibson assembly kit (NEB) and confirmed by sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: Indexed ChIP-seq libraries were constructed using the Next Ultra Library Prep Kit for Illumina (New England Biolabs) using the application note ‘Low input ChIP-seq’ ...
-
bioRxiv - Neuroscience 2019Quote: ... Libraries were prepared from 90ng of RNA from each sample using the NEBNext Ultra kit (New England BioLabs) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Immunoprecipitated chromatic DNA was subjected to library preparation using NEBNext Ultra II DNA Library kit (NEB cat# E7645S). Briefly ...
-
bioRxiv - Microbiology 2019Quote: Libraries for RNAseq were prepared using the NEB Next Ultra Directional RNA Library Prep Kit (New England Biolabs). Individual libraries were uniquely barcoded with NEBNext Multiplex Oligos for Illumina sequencing platform (New England Biolabs) ...
-
A general role of zinc binding domain revealed by structures of σ28-dependent transcribing complexesbioRxiv - Molecular Biology 2020Quote: ... RNA library was constructed using a NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina (NEB) and sequenced by Illumina HiSeq X Ten platform.
-
bioRxiv - Biochemistry 2020Quote: Total RNA was extracted from HLCs using the Monarch® Total RNA Miniprep Kit (New England BioLabs, T2010). cDNA was generated using the High Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems ...
-
bioRxiv - Genomics 2019Quote: ... in 57 ml using end repair buffer from NEBNext Ultra II DNA library preparation kit for Illumina (NEB). Glucosylated DNA was then end repaired without purification followed by ligation to Pyrrolo-dC adaptors as indicated in NEBNext Ultra II DNA library preparation protocol (NEB ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA) using 1 µg DNA ...
-
bioRxiv - Genomics 2021Quote: Final libraries were prepared on beads using the NEB-Next Ultra II DNA Library Prep Kit (NEB, #E7645) as follows ...
-
bioRxiv - Microbiology 2020Quote: ... Amplicons were processed for sequencing using the NEBNext Illumina library preparation kit (New England Biolabs, Whitby, ON, Canada) and sequenced with 2×250 bp cycles of v2 Miseq chemistry (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the RNA sample was used as input for an NEBNext Small RNA Library Prep for Illumina kit (NEB). Barcoded amplicons were sequenced on a MiSeq (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and libraries were assembled using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) with NEBNext Multiplex Oligos for Illumina primer sets (NEB #E7335 and #E7500) ...
-
bioRxiv - Immunology 2021Quote: ... the RNA sequence library was prepared using the NEBNext Ultra Directional RNA Library Prep Kit (New England Biolabs). Paired-end sequencing was performed with NextSeq500 (Illumina) ...
-
bioRxiv - Genomics 2020Quote: An Illumina sequencing library was also prepared using a NebNext Ultra DNA II Kit (New England Biolabs, USA). The library was sequenced on a HiSeq X10 (150bp paired end reads ...
-
bioRxiv - Plant Biology 2020Quote: ... Sequencing libraries were generated using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina (NEB, USA). Clustering of index-coded samples was performed on a cBot Cluster Generation System using TruSeq PE Cluster Kit v3-cBot-HS (Illumina) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 500 ng of gel purified mononucleosomal DNA were repaired using the PreCR Repair Mix Kit (New England Biolabs) with 100 µM dNTPs in a 50 µL reaction ...
-
bioRxiv - Developmental Biology 2021Quote: ... sequencing libraries were generated using NEBNext®Ultra™RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... The Myc-tagged Nix-S212A and Nix-S212D were generated using a Q5 mutagenesis kit (New England Biolabs). The lentiviral shNix (Addgene #100770 ...
-
bioRxiv - Cell Biology 2021Quote: ... and PCR amplification were performed using the Truseq Small RNA Sample Prep Kit for Illumina (NewEngland Biolabs, E7335S) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: Total RNA was extracted from HLCs using the Monarch® Total RNA Miniprep Kit (New England BioLabs, T2010). RNA integrity was assessed using a Bioanalyzer (Agilent ...
-
bioRxiv - Bioengineering 2021Quote: ... were amplified by PCR and cloned into the pX601 plasmid using an NEBuilder HiFi DNA assembly kit (NEB).
-
bioRxiv - Bioengineering 2021Quote: ... The product was cloned into a pSB3K3 vector using either NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) or the MEGAWHOP protocol54 based on a plasmid carrying the inactive variant E418A ...
-
bioRxiv - Biochemistry 2020Quote: ... The DNA was immediately purified using a DNA cleanup column (the Monarch PCR & DNA cleanup kit from NEB) and eluted with water ...
-
Persistent DNA damage rewires lipid metabolism and promotes histone hyperacetylation via MYS-1/Tip60bioRxiv - Cell Biology 2021Quote: ... Sequencing libraries were generated using NEBNext®Ultra™RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids encoding various dSARM1ARM mutants were generated using the Q5® Site-Direct Mutagenesis Kit (New England BioLabs). Plasmids were transformed into BL21 (DE3 ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA library was prepared using the NEBNext Ultra Directional RNA Library Prep Kit (#E7420, New England BioLabs) for Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 8 μL of RNA was added per section to step 2.1 through to 2.11.11 of the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB) using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB #E7645L) following manufacturer’s instructions and NEB Next Multiplex Oligos for Illumina (96 Index Primers ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA libraries were prepared using NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sequencing libraries were prepared with NEBNext® UltraTM II kit for Illumina (cat# E7645S) (New England Biolabs, MA) and exomes were captured with SSELXT Human All exon V6 +UTR probes (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... an NLS sequence was inserted downstream of the TagRFP sequence in the Cb expression vector described above with primers nls-insert_for and nls-insert_rev using the Q5 Site-Directed Mutagenesis Kit (NEB) and the resulting plasmid was used as a template to subsequently amplify the TagRFP-NLS sequence using the primers frag3-tRFP-nls_for and frag3-tRFP-nls_rev ...
-
bioRxiv - Plant Biology 2021Quote: ... The K107E and ΔSTART mutations in PDF2 were generated using Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The L480P mutation in GL2 was generated by one-step PCR-based site-directed mutagenesis (Scott et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... total RNA was extracted using Monarch Total RNA Miniprep kit including DNAse treatment on column (New England Biolabs). m7G-RIP was then performed as previously described49 with slight modifications ...
-
bioRxiv - Biochemistry 2020Quote: ... Amino acid substitutions were made using the Q5 Site-directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA) to generate pNG309 and pNG307 for expression of xoxF1 D320A and exaF D319S ...
-
bioRxiv - Microbiology 2020Quote: ... Catalytically inactive Mt2 (Mt2 C78A) variant was generated via site-directed mutagenesis (NEB, Q5 Site-Directed Mutagenesis Kit) using primers listed in the primer table (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were created using NEBNext® Ultra(tm) Directional RNA Library Prep Kit (New England BioLabs, Frankfurt, Germany). Pooled libraries were loaded on the cBot (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... DNA libraries were prepared using the NEB Next Ultra DNA Library Prep kit for Illumina (New England BioLabs). Approximately 10 Gb were sequenced with a HiSeq X Ten instrument as paired-end 150 bp reads ...
-
bioRxiv - Microbiology 2020Quote: ... cDNAs were synthesized from RNA using the LunaScript™ RT SuperMix Kit from New England BioLabs (NEB, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... then RNA-seq libraries were prepared using the NEBNext Ultra II Directional mRNA-seq kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... Ribo-depleted RNA was then prepared for sequencing using the NEBNext Ultra Directional RNA kit (NEB product E7420), and sequenced as described above for the DNA samples.
-
bioRxiv - Cancer Biology 2020Quote: ... site-directed mutagenesis was carried out using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Cat# E0554S) to introduce a stop codon ...
-
bioRxiv - Plant Biology 2021Quote: ... the mutations were generated in pBridge-PIF3-N1 with the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). The primers used to generate the m1 to m15 mutants are listed in Supplementary Table 2 ...
-
bioRxiv - Systems Biology 2020Quote: ... The NCK2 SH3 shuffled chimeras were constructed using NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, Inc). The different functional regions of NCK2 are based on NCBI (NP_035009.3 ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were generated using NEB Next® Ultra™ DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations and index codes were added ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Genomics 2021Quote: Final libraries were prepared on beads using the NEB-Next Ultra II DNA Library Prep Kit (NEB, #E7645) as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA sequencing libraries were created using the NEBNext Ultra II Directional RNA-Seq library kit (NEB, Ipswich, MA) according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... The mutants DSR2 (N133A) and DSR2 (H171A) were constructed using the Q5 Site-directed Mutagenesis kit (NEB, E0554S) using eaither primers JG216 and JG217 ...