Labshake search
Citations for New England Biolabs :
5051 - 5100 of 9547 citations for QuantiChrom Phosphate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... University of Cambridge) using the NEBuilder HiFi DNA Assembly kit based on the manufacturer’s instructions (New England Biolabs). Transgenic animals were validated by reverse transcription PCR targeting the correct insert ...
-
bioRxiv - Cell Biology 2022Quote: ... The sequencing libraries were prepared with a NEBNext Ultra II DNA library preparation kit (NEB, Ipswitch, MA, USA) with 10 cycles of PCR amplification ...
-
bioRxiv - Cell Biology 2022Quote: ... and used to prepare libraries with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) with 11 amplification cycles ...
-
bioRxiv - Genetics 2022Quote: ... RNA sequencing libraries were constructed using the NEBNext Ultra RNA Library Prep Kit (New England Biolabs, Ipswich, MA) following manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... and RNA-seq libraries were constructed using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB E7770) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA-seq libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770) following the manufacturer’s instructions ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... The MSCV murine ADAR2E396A expression construct was generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). Clones were screened and confirmed by Sanger sequencing.
-
bioRxiv - Biochemistry 2022Quote: ... All of the mutations were introduced using the Q5 site directed mutagenesis kit (New England Biolabs, Ipswich, MA) with primers listed (Supplementary Table 2).
-
bioRxiv - Cancer Biology 2022Quote: ... and Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA). Index codes were added to attribute sequences to each sample ...
-
bioRxiv - Bioengineering 2022Quote: ... sequencing libraries were generated using the NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA), and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Genomics 2022Quote: ... The correct size band was cut and purified with the Monarch Gel Extraction Kit (New England BioLabs T1020L). The insert single-stranded DNA was diluted to 1 μM with H2O ...
-
bioRxiv - Developmental Biology 2022Quote: ... before DNA library preparation using the NEB Ultra II DNA Library Prep Kit for Illumina (New England BioLabs) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and the sequencing libraries were synthesized using a NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB). Sequencing was performed using a NextSeq 500 Sequencer (Illumina ...
-
bioRxiv - Developmental Biology 2022Quote: ... and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1, NEB, E7335L). Conditions for PCR used are as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1, NEB, E7335L). Conditions for PCR used are as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs) size selection ...
-
bioRxiv - Genetics 2022Quote: ... The RNA was transcribed using 1ug of template with the HiScribe T7 Quick High Yield kit (NEB, E2050) according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were generated using the NEBNext Ultra II Directional Library Prep Kit (New England Biolabs, Ipswich, MA, USA) and subjected to sequencing (single-end 92× ...
-
bioRxiv - Genomics 2022Quote: ... Short-read sequencing libraries were constructed using NEBNext Ultra II DNA Library Prep kit for Illumina (NEB, USA) at the University of Melbourne ...
-
bioRxiv - Immunology 2022Quote: ... parkeri- infected ticks using the NEBNext Ultra™ RNA library Prep Kit (New England Biolabs, Ipswich, MA, USA). RNA library preparation and sequencing were conducted by Novogene Co. ...
-
bioRxiv - Genomics 2022Quote: ... 300 bp and 500 bp) were prepared using the NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) according to the standard protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The amplified fragment was cloned into pSEVA121 using the NEBuilder® HiFi DNA Assembly kit (New England BioLabs) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... quantified using the NEBNext Ultra RNA Library Prep Kit for Illumina (Cat No. 7530, New England Biolabs (NEB)) ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... Barcoded libraries were made with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Libraries were pooled and sequenced (single-end 75 bp reads ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA libraries were generated using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, cat# E7103S) according to the manufacturer’s instructions with the following modification for bisulfite treatment ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Microbiology 2022Quote: ... The libraries for sequencing were constructed using the NEB Next Ultra RNA Library Prep Kit for Illumina (NEB). The poly (A)-tailed mRNA was enriched using the NEB Next Poly (A ...
-
bioRxiv - Microbiology 2022Quote: ... sequencing libraries were generated using the NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) with 1 μg of total RNAs ...
-
bioRxiv - Microbiology 2022Quote: ... and RNA-Seq libraries were generated using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB # E7760L). Two biological replicates were sequenced using the Illumina NextSeq 550 platform to generate 150 bp PE reads ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesis was conducted via ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich MA, USA), using manufacturer’s instructions for reverse transcription of total RNA ...
-
bioRxiv - Systems Biology 2022Quote: ... The libraries were indexed with NEBNext Multiplex Oligos kit for Illumina (96 Index Primers, New England Biolabs, USA). Size distribution for the libraries and their quality were assessed using a high-sensitivity DNA chip (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extracted RNA from light and heavy fractions were subjected to qRT-PCR using Luna RT-qPCR kit (NEB).
-
bioRxiv - Plant Biology 2022Quote: ... ChIPseq libraries were prepared by NEBNEXT® UltraTM II DNA Library Prep Kit for Illumina (New England Biolabs) and sequenced using NovaSeq 6000 system (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... and a single band of the expected size was purified using Monarch Gel Extraction Kit (New England Biolabs). Purified amplicons from 6 Cas9-only control injected larva and from 24 gRNA-injected (and imaged ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and cloned into XbaI site of the pLS-mP-luc using NEBuilder HiFi DNA Assembly Cloning Kit (NEB). Fragments that failed to clone (human 2xHAR.11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... linearized plasmid by performing an in vitro transcription with SP6 using the Hiscribe SP6 RNA kit (#E2070S, NEB) and a cap analog from the ARCA kit (#S1411 ...
-
bioRxiv - Zoology 2023Quote: ... sequencing libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit (New England BioLabs, Frankfurt, Germany) according to the manufacturer’s instructions without prior fragmentation ...
-
bioRxiv - Neuroscience 2022Quote: ... Sequencing libraries were generated using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted using the Monarch® HMW DNA Extraction Kit (New England Biolabs, T3050S and T3060S) using manufacture’s protocol for iPSC samples ...
-
bioRxiv - Neuroscience 2022Quote: ... Complementary DNA (cDNA) was synthesized from 200ng RNA using LunaScript® RT-SuperMix kit (New England Biolabs #E3010). RT-qPCR reactions were performed using Luna® Universal qPCR Master Mix (New England Biolabs #M3003) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Y350A mutations of WW domains in Yki were generated by Q5 Site-Directed Mutagenesis Kit (NEB, Cat# E0554S) using pMT-yki-HA as a template ...
-
bioRxiv - Genomics 2022Quote: ... The purified product was then in vitro transcribed using “HiScribe T7 High yield RNA Synthesis Kit (NEB, E2040S) and purified using Monarch RNA Cleanup Kit (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... histolytica RNA was prepared using the Monarch Total RNA Miniprep Kit (NEW ENGLAND BioLabs, Ornat, Nes Ziona, Israel). According to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Sequencing libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... and RNAseq libraries were prepared using the NEB Ultra II Directional RNA library Prep kit (New England Biolabs), with 1 ug total RNA input and initial poly(A ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 uL of Quick Ligation Buffer and 5 uL of Quick T4 Ligase (NEB Quick Ligation Kit, M2200S). The ligation reaction was incubated for 10 minutes at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... viral cDNA was synthesized from the extracted RNA by using a LunarScript RT SuperMix Kit (New England BioLabs). The DNA was then amplified by performing a multiplexed PCR in two pools using the ARTIC-N5 primers and the Q5 Hot Start DNA polymerase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instruction and further purified using a Monarch® RNA Cleanup Kit (50 μg) (NEB). RNA integrity was monitored with agarose gels ...
-
bioRxiv - Microbiology 2022Quote: ... A sequencing library was generated using the NEB Next® Ultra™ DNA Library Prep Kit (NEB, USA) following the manufacturer’s recommendations and index codes were added to each sample ...