Labshake search
Citations for New England Biolabs :
5001 - 5050 of 5199 citations for 4 2 Hydroxy 1 Methoxyethyl 1 2 Benzenediol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... The PCR products were run on a 1% agarose gel stained with ethidium bromide alongside a 100 bp ladder (New England Biolabs, Ipswitch, MA, USA).
-
bioRxiv - Biochemistry 2020Quote: ... The PCR amplification was performed with 10 µl of the reverse transcriptase product in a 50 µl PCR mix containing 1 unit of Phusion High-Fidelity DNA polymerase (New England Biolabs, Évry-Courcouronnes, France), 1X HF Phusion buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... fraction #2 of all samples as well as a positive control of U1 snRNP were incubated with 1 μl of proteinase K (NEB, 800 units/ml) for 30 min at 37 °C and loaded onto a denaturing gel (8% acrylamide/bis-acrylamide ...
-
bioRxiv - Pathology 2021Quote: ... The DNA fragment encoding the desired FLAG-TEV tag was generated via PCR using primer pair 2 (table 1) and subsequently cloned into the NdeI restriction site of pET24Δlac/Ep-CoV2 using NEBuilder® HiFi DNA Assembly (NEB, Ipswich, MA, USA).
-
bioRxiv - Genomics 2020Quote: ... genomic DNA libraries were constructed for sequencing on Illumina platforms using the NEBNext® DNA Sample Prep Master Mix Set 1 (New England Biolabs, Ipswich, MA). First ...
-
bioRxiv - Microbiology 2020Quote: ... with rotation for 1 hour at room temperature followed by further incubation for 1 hour with the addition of 15 μl of goat anti-mouse IgG magnetic beads (New England Biolabs, Ipswich, MA, USA). The magnetic beads in the supernatant were collected on a magnetic stand and washed 2 times with PBS ...
-
bioRxiv - Microbiology 2021Quote: ... The transcription levels of the HO-1 gene were detected using the Luna Universal qPCR Master Mix (New England Biolabs Japan, Tokyo, Japan). Real-time PCR was performed using Mastercycler ep realplex2 (Eppendorf ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Physiology 2022Quote: ... The single stranded cDNA was ligated with a partial Illumina 5’ adaptor (HZG885:/5phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTddC) using T4 RNA ligase 1 (New England Biolabs, Ipswich, MA, US) and incubated overnight at 22 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fixed cells were resuspended in 1 mL spheroplast buffer (1.2 M sorbitol, 0.1 M potassium phosphate, 20 mM vanadyl ribonuclease complex [NEB S1402S], 20 µM beta-mercaptoethanol), and 1.2–5 µL 100T zymolyase (US Biological Z1005 ...
-
bioRxiv - Bioengineering 2022Quote: ... and mRNA was isolated from ∼1 μg of total RNA using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB, Cat. No. / ID: E7490). RNA-seq libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB ...
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: ... The NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® with the NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1) were used to generate DNA libraries for sequencing (New England Biolabs, USA) as per the manufacturers protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 – 1 μg DNA template were in vitro transcribed using HiScribe® T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA), following manufacturer’s instruction ...
-
bioRxiv - Genetics 2023Quote: ... 1 μg of RNA was used to generate sequencing libraries using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following polyA selection ...
-
bioRxiv - Genomics 2023Quote: ... This 17 µl of DNA solution was incubated with 3 µl digestion mixture containing 1 µl BciVI (New England Biolabs, cat. no. R0596S) and 2 µl CutSmart buffer (New England Biolabs ...
-
bioRxiv - Bioengineering 2023Quote: ... and mRNA was isolated from ∼1 μg of total RNA using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB, Cat. No. / ID: E7490). RNA-seq libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Genomics 2023Quote: ... and single colonies were picked 1 day later to grow up and extract plasmid DNA using a Monarch Plasmid Miniprep Kit (New England Biolabs, Cat. No. T1010L). Extracted plasmid DNA was sequence confirmed via long-read Nanopore sequencing (Primordium Labs ...
-
bioRxiv - Genomics 2023Quote: ... The cDNA libraries were constructed from 1 ug input RNA using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB), following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Adaptor ligation was performed with 1:25 diluted adaptor and 15 cycles were used for library amplification using dual indices (NEB dual index kit). Paired-end 2×25 bp sequencing was performed on a NextSeq500 Illumina Sequencer.
-
bioRxiv - Cell Biology 2022Quote: ... 15 μL of cell lysate was further treated for 1 h at 37°C with 40 units of Quick calf intestinal alkaline phosphatase (CIP, New England Biolabs, Ipswich, MA, USA) per the manufacturer’s recommendations ...
-
HTLV-1 Splice Sites in Prevalent Gene Vectors Cause Splicing Perturbations in Transgenic Human CellsbioRxiv - Genomics 2023Quote: ... Following magnetic bead purification one third of the cDNA per sample was subjected to PCR amplifications with the primers HTLV-1 and PE-2nd-GA using the NEBNext® Ultra™ II Q5® Master Mix (NEB) using the cycling program ...
-
bioRxiv - Genomics 2023Quote: ... We purified and enriched mRNA from 1 ug of total RNA using the NEBNext Poly(A) Magnetic Isolation Module (New England Biolabs, catalog no. E7490L). RNA fragmentation ...
-
bioRxiv - Cancer Biology 2023Quote: ... we dispensed 5 μL of a sense oligo and then added 40 μL of phosphorylation reaction mix containing 1 μL of T4 Polynucleotide Kinase (PNK; NEB, cat. no. M0201S), 5 μL of T4 PNK buffer (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... The DNA fragments encoding enriched peptide genes were mixed with sfGFP gene portion and assembled by 1 hour incubation at 50°C using HiFi Master mix (NEB Japan, Tokyo, Japan). The reaction mixture was then used in PCR amplification with primers 13 and 14 to obtain peptide-sfGFP gene fragments suitable for cell-free protein synthesis ...
-
bioRxiv - Molecular Biology 2023Quote: 1 µg of total RNA was used to perform mRNA isolation using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB Cat. No. E7490). The resulting mRNA material was used to prepare the libraries with the use of NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... Adaptor ligation was performed with 1:25 diluted adaptor and 15 cycles were used for library amplification using dual indices (NEB dual index kit). Paired-end 2×25 bp sequencing was performed on a NextSeq500 Illumina Sequencer.
-
bioRxiv - Cancer Biology 2023Quote: ... The sequencing libraries were prepared following Chapter 1 of the NEB® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England BioLabs, NEB) protocol ...
-
bioRxiv - Genomics 2023Quote: ... We then ligated barcodes to the end-prepped DNA using the Native Barcoding Expansion 1–12 kit (EXP-NBD104, Oxford Nanopore Technologies, Oxford, UK) and Blunt/TA Ligase Master Mix (New England Biolabs, Ipswich, MA, USA). We cleaned the barcoded samples using 0.9X AMPure XP beads ...
-
bioRxiv - Genomics 2023Quote: ... using the Adapter Mix II from the Native Barcoding Expansion 1–12 kit and NEBNext Quick Ligation Reaction Buffer (New England Biolabs, Ipswich, MA, USA) as well as Quick T4 DNA Ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... each containing 50 ng of DNA (comprising both vector and insert at a 1:3 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was incubated at 16°C overnight and column-purified with molecular biology-grade water ...
-
bioRxiv - Bioengineering 2024Quote: ... along with a well containing 10 µl Quick-Load® Purple 1 kb DNA Ladder (New England Biolabs catalog no. N0552S; New England BioLabs, Ipswich, MA) and ran at 105 V for 45 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... F: agaagtcttagcatatgtggtac R: aacagatgttggacccttcc RNA diluted at 1/100 was amplified using Luna® Universal One-Step RT-qPCR Kit (NEB, Ipswich, MA) according to the manufacturer’s directions on a QuantStudio3 (Applied Biosystems ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 μL of the supernatant was used as template for PCR using the Q5® High-Fidelity 2X Master Mix (NEB, Cat. # M0492L) and the primer pair prCP222-prCP223 to amplify FCY1 (Table S2) ...
-
bioRxiv - Plant Biology 2024Quote: ... to create a level-1 plasmid by cut and ligate reaction using BsaI restriction enzyme and T4 DNA ligase from NEB (New England Biosciences). All plasmids were confirmed by restriction digestion and DNA sequencing ...
-
bioRxiv - Cell Biology 2024Quote: ... was used to do the library according to the manufacturer protocol with the following index set NEBNext Multiplex Oligos for Illumina (Dual-Index Primers Set 1; NEB, cat. no. E7600S) and sequenced on AVT system.
-
bioRxiv - Genetics 2021Quote: ... 2nd cDNA strand was again synthesized using a transcript specific primer (either 5’UTR_βG-intron _F or 5’UTR_CMV _F2, Table 4) and Q5 2x master mix (NEB, #M0494). After another round of bead purification ...
-
bioRxiv - Biochemistry 2020Quote: ... Lysates were centrifuged at 30,597xg and 4°C for 20min and the supernatant was applied to amylose resin (NEB). The column was washed with 10 column volumes (CV ...
-
bioRxiv - Biochemistry 2020Quote: ... Vector and fragment were ligated in an overnight reaction at 4 °C using T4 DNA Ligase (New England Biolabs). After transformation ...
-
bioRxiv - Cell Biology 2021Quote: ... centrifuged at 58,000 × g for 50 minutes at 4°C and the protein was batch purified using chitin beads (NEB). Protein-bound chitin beads were washed with lysis buffer and high salt buffer (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... The region of interest was amplified with specific primers (see Supplemental Table 4) and the Q5 DNA polymerase (NEB), and indexed by PCR using primers containing Illumina indexes (see Supplemental Table 4) ...
-
bioRxiv - Biophysics 2020Quote: ... T270 plasmid was digested by HpaI at 37°C for 4 hr in the CutSmart buffer (New England BioLabs) to place the (TTAGGG)270 at the middle region of the linearized substrate ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysate was cleared by centrifugation (20 min, 20,000 × g, 4°C) and protein was purified on amylose resin (NEB) including a high salt wash with buffer containing 25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Genomics 2022Quote: ... Next, 500 nL of MspJI digestion mix (1x NEBuffer 4, 8x enzyme activator solution, 0.1 U MspJI (NEB, R0661L)) was added to each well and the plates were incubated at 37°C for 4.5 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates were cleared via centrifugation at 30,597xg and 4°C for 20 min and the supernatant was applied to amylose resin (NEB). The column was washed with 15 column volumes (CV ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was performed on 4 ng of pKD3 plasmid using Q5 High-Fidelity 2X Master Mix (New England Biolabs). The PCR product was digested for 1 hour with the restriction enzymes DpnI and ClaI at 37°C and then the PCR product was run on a 1% agarose gel ...
-
bioRxiv - Molecular Biology 2021Quote: ... sequence in a reaction containing 40 ng/μl DNA (4 μg total) and 0.5 U/μl restriction enzyme (HindIII-HF; NEB, Cat ...
-
bioRxiv - Immunology 2021Quote: ... 5’ arm of homology to exon 5 of the Il22 gene was cloned into NotI-EcoRI-digested pMACs 4-IRES.II (contains EMCV IRES and truncated hCD4) using T4 DNA Ligase (NEB). Second ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Barcodes (4-8 bp) and common adapters were ligated with 400 U T4 DNA ligase (New England Biolabs Inc.) at 22 C for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... 4°C and the supernatant applied on a 6 ml gravity flow column with Chitin resin (New England Biolabs), equilibrated with 20 mM HEPES ...
-
bioRxiv - Immunology 2024Quote: ... mRNA was purified from 4 µg of total RNA with a magnetic mRNA isolation kit (New England Biolabs, S1550S). cDNA was synthesized from mRNA samples with M-MLV (New England Biolabs ...