Labshake search
Citations for New England Biolabs :
451 - 500 of 953 citations for Lupatadine fumarate EP Impurity C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were then incubated at 42°C overnight with the addition of 3 μl of β-agarase (NEB). The DNA mix was then gently poured into combing reservoirs containing 1.2 ml MES and the genomic DNA was combed onto salinized coverslips (Genomic Vision ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 μl of a mix preheated to 37°C and containing 2.5 U of RNase H (New England Biolabs), 2.5× RNase H reaction buffer (1× buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... N- and C-terminal linkers of R-iLACCO0.1 were deleted using Q5 high-fidelity DNA polymerase (New England Biolabs) to provide variants with different linker length ...
-
bioRxiv - Microbiology 2023Quote: ... RNA and 3′ adapters were incubated at 22°C for 2.5 hr with 51 U of T4 RNA Ligase I (NEB) and 12 U of recombinant RNase inhibitor (Takara Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10-15 ng of each PCR product were digested at 37 °C for 60 min with 2.5 units of XcmI (New England Biolabs) in 15 μl reactions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the parts were assembled with Gibson assembly (NEBuilder HiFi DNA Assembly Master Mix from NEB, 1h at 50°C) with the linkers providing sequence overlaps ...
-
bioRxiv - Biochemistry 2023Quote: ... In a 50 μL reaction 1 μg of backbone plasmid (starting_eGPARK2iM) was digested at 37 °C for 1 hour with MluI-HF and EcoRI-HF (New England Biolabs), then heat-inactivated at 65 °C for 20 minutes ...
-
bioRxiv - Biochemistry 2023Quote: The library was ligated to the barcode oligonucleotide at a 7:1 oligo:library ratio overnight at 16 °C with T4 DNA ligase (New England Biolabs). A no-insert negative control was also ligated overnight using identical conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 μl of 0.1∼1 μg genomic DNA was mixed with 10 μl of 2X C-circle master mix [0.2 mg/ml BSA (NEB), 0.2% Tween-20 ...
-
bioRxiv - Biophysics 2023Quote: ... We digested the cosmid-i95 for 2 h at 37°C using SpeI-HF restriction enzyme (New England Biolabs) and heat-inactivated for 20 min at 80°C ...
-
bioRxiv - Molecular Biology 2023Quote: For DNA-RNA hybrid IP (DRIP) non-crosslinked lysates were incubated (1 h, 37°C) with 10U RNaseH (NEB) prior to immunoselection ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7.5 µL DNA was incubated (14 h, 37°C) with IVT mix (0.5 µL Ribolock inhibitor, Invitrogen, 2 µL T7 polymerase buffer, NEB, 8 µL rNTP mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... 37°C with rotation) in 100 µL MNase reaction mix (87 µL ddH2O, 10 µL 10x MNase buffer, NEB, 1 µL 100x BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... The extracted chromatin was digested for 3 hours at 37 °C in a volume of 250.0 μL with 100 U of NlaIII (NEB) for 3C library preparation ...
-
bioRxiv - Microbiology 2023Quote: ... An aliquot of 10 μg DNA was digested overnight at 37°C using NlaIII and MseI restriction enzymes (NEB), purified using Sera Mag Speedbeads (Thermo Scientific) ...
-
bioRxiv - Biophysics 2022Quote: ... The C-terminal Flag tag was introduced into pcDNA3.1-Spike-WT thanks to NEBuilder® HiFi DNA Assembly (NEB). The Flag tag was added during amplification of Spike-WT from pcDNA3.1-Spike-WT with the primers ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was inactivated at 25 °C for 10 min with 1.25 μL of Murine RNAse inhibitor (New England Biolabs).
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 mM EDTA) and digested with DraIII-HF in 1x CutSmart buffer for ∼20 hr at 37 °C (NEB). Fragments with DraIII sticky ends were re-purified by 1 mL mono-Q ion-exchange ...
-
bioRxiv - Cell Biology 2023Quote: ... APOE3-C-mEm ΔSS were created from APOE3-mEm using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554S). The N-terminal domain constructs consist of residues 19-209 with or without residues 1-18 of the N-terminal signal peptide ...
-
bioRxiv - Cancer Biology 2023Quote: ... were then denatured at 95°C for 5 min and cooled at room temperature to form heteroduplexes using NEBuffer2.1 1x (NEB). The T7 endonuclease I (NEB ...
-
bioRxiv - Immunology 2023Quote: ... The libraries were generated by blunt-end cloning of 1,200 ng fragmented DNA into 1,000 ng PmeI linearized and dephosphorylated pHORF3 library vector (a gift from Michael Hust, Technische Universität Braunschweig) (16 hr at 16 °C, T4 DNA Ligase, NEB). The ligation reaction was purified and transformed into TG1 bacteria (Lucigen ...
-
bioRxiv - Molecular Biology 2023Quote: ... a ratio of 7:1 (oligo:library) was used overnight at 16 °C with T4 DNA ligase (New England Biolabs). The products were purified and eluted in 6 μL water (Zymo Clean and Concentrate) ...
-
bioRxiv - Genomics 2023Quote: Hi-C single-index library preparation of MCF7 cells was performed as previously described using MboI (New England Biolabs) restriction enzyme (30).
-
bioRxiv - Cell Biology 2023Quote: ... nuclei were collected by centrifugation at 800g for 10 minutes at 4°C and resuspended in 1.2 X of NEB buffer 2.1 (New England Biolabs, B7202). 1 x 107 nuclei were then solubilized with 0.3% SDS for one hour at 37°C followed by adding 1.8% of TritonX-100 and incubating one hour at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were digested with 0.4 μl of restriction enzyme NlaIII for 2 hours at 37°C (New England Biolabs). Digested PCR products were run on 2% agarose gels with SYBR Safe (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: ... Barcodes were amplified by PCR (CP21.P14: TCCTCATCCTCTCCCACATC, CP17.P12: GGACGAGGCAAGCTAAACAG, NEB Q5 for 20 cycles, Tm 67 °C). We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles ...
-
bioRxiv - Synthetic Biology 2024Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in the Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Immunology 2024Quote: ... MO were stored at 4°C in water at 1 mM and diluted for injections with 0.5X CutSmart Buffer (NEB) and 0.1% phenol red ...
-
bioRxiv - Microbiology 2024Quote: ... primers TZ-54 and TZ-55 were used to amplify the C-terminus of CapRelSJ46 using Taq polymerase (NEB) and 0.5 mM MnCl2 was added to the reaction as the mutagenic agent ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... were split into two equal samples and incubated at 50°C for 25 minutes with exonuclease 1 (NEB, M0293) to remove unintegrated barcoded transposon adapters ...
-
bioRxiv - Plant Biology 2024Quote: ... and SLAC1 cDNAs (N-terminal or C-terminal) were cloned in-frame into pMAL-c5X vector (New England Biolabs) using In-Fusion HD Cloning Kit (Takara Bio) ...
-
bioRxiv - Molecular Biology 2024Quote: ... proximity ligation was carried out overnight at 16°C with 10000U of T4 DNA Ligase (New England Biolabs, #M0202M). Chromatin was reverse-crosslinked with 16U of Proteinase K (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... plus 100 µg/mL BSA) and A-tailed (30 min 37°C; NEBNext® dA-Tailing Module; NEB, E6053L) with intervening CutsmartTM washes ...
-
bioRxiv - Cell Biology 2024Quote: Purified or crude viral supernatant was DNase I treated for 90 minutes at 37°C according to manufacturer’s instructions (New England BioLabs). qPCR was performed using a custom FAM probe against Nano Luciferase (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... treated or not for one hour at 56°C with 0.4 mg/mL proteinase K (P8107S, New England Biolabs) and then heated or not for one hour at 85°C.
-
bioRxiv - Cell Biology 2024Quote: ... Ligation reactions were quenched by addition of EDTA to 25 mM and proteins were digested by incubation at 37°C for 20 min with 0.1% SDS and 20 units/ml proteinase K (NEB). Unligated oligonucleotides were removed by gel filtration through a 50 cm x 0.7 cm Sepharose 4B column (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... Ligation reactions were carried out overnight at 16°C using 1µl of T4 DNA Ligase (20 U/µl; NEB). Plasmids were then cloned in E ...
-
bioRxiv - Immunology 2024Quote: ... The ligation reaction was performed at 16 °C for 16 hours using 2.5 units of T4 DNA ligase (M0202, New England Biolabs). Subsequently ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 8.0) for 1 h at 37 °C and washes in CSTX buffer (1× CutSmart buffer (New England Biolabs (NEB) B60004) ...
-
bioRxiv - Molecular Biology 2024Quote: The C-type CA sequence was cloned into pCMVHTLV_delta env (kind gift from Dimitry Mazurov) by Gibson Assembly (NEB) and all subsequent point mutations were introduced by standard overlapping PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... 87 µL of CAD was activated by addition of 10µL of TEV buffer and 3µL of TEV enzyme for 1hr at 30°C (NEB, P8112S).
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA synthesis was performed in 20 µl at 42°C for 1 h using AMV reverse transcriptase (NEB, M0277), and 5 µl of the RT reaction was amplified in 25 µl using AccuPrime Pfx DNA polymerase (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA synthesis was performed in 20 µl at 42°C for 1 h using AMV reverse transcriptase (NEB, M0277), and 5 µl of the RT reaction was amplified in 25 µl using AccuPrime Pfx DNA polymerase (ThermoFisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... The WI290>C substitution was generated in the pMSCV-FGFR2wt construct using the Q5 site-directed mutagenesis kit (NEB). pMSCV-Blasticidin (empty vector ...
-
bioRxiv - Genomics 2024Quote: ... the RT product was digested overnight at 37°C with 1 unit of USER Enzyme (New England Biolabs, M5505L) per µg of product ...
-
bioRxiv - Immunology 2024Quote: ... TeeVax3 antigen was buffer exchanged into 20 mM Tris pH 7.5 and digested overnight at 4 °C with TEV Protease (NEB). Undigested antigen and digested His tags were captured by Ni-NTA chromatography as described above ...
-
bioRxiv - Genomics 2024Quote: ... a 16 hour RCA reaction was performed at 30°C using a mixture containing 500 µM dNTP (NEB #N0447S), 50 µM amino-allyl-dUTP (Thermo Scientific #R1091) ...
-
bioRxiv - Biochemistry 2024Quote: ... Methylation proceeded for 30 minutes at 37°C before adding 10µL of 10% SDS 2.5µL ProK (NEB, 800U/mL). Proteinase K digestion proceeded for 2 hours at 65°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Reactions were incubated at 37°C for 3 hours then digested with 64 units of RNase Free DNaseI (NEB) at 37°C for 15 minutes ...
-
bioRxiv - Genomics 2024Quote: ... 10 mM DTT and 300 mM sucrose) and incubated for 7.5 minutes at 37°C with 200U of M.CviPI (NEB M0227L) and 0.6 mM SAM (NEB) ...