Labshake search
Citations for Illumina :
51 - 100 of 2347 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... Bead-bound Hi-C DNA was amplified with 7 PCR amplification cycles using PE PCR 1.0 and PE PCR 2.0 primers (Illumina). After PCR amplification ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bead-bound DNA was amplified with 6 PCR amplification cycles using PE PCR 1.0 and PE PCR 2.0 primers (Illumina). Primary samples T-ALL 2-5 ...
-
bioRxiv - Genetics 2023Quote: ... After a post-capture PCR (four amplification cycles using Illumina’s PE PCR 1.0 and PE PCR 2.0 primers), the PCHi-C libraries were purified with AMPure XP beads (Beckman Coulter #A63881 ...
-
bioRxiv - Genetics 2021Quote: ... DNA was PCR-amplified with TruSeq dual indexing primers (Illumina) to generate Illumina compatible libraries ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... followed by tailed-PCR using Nextera XT Index Primers (Illumina) (S1B Fig) ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary PCR was performed using Nextra XT index primers (Illumina). The secondary PCR condition was 95 °C (20 sec) ...
-
bioRxiv - Microbiology 2023Quote: ... followed by PCR amplification using TruSeq-designed primers from Illumina guidelines ...
-
bioRxiv - Immunology 2019Quote: ... PCR products were indexed by Nextera XT index Kit Set A and Set D (Illumina; FC-131– 2001 and FC-131–2004) according to Illumina’s protocol for 16S metagenomic library preparation ...
-
bioRxiv - Microbiology 2023Quote: ... Both primer sets were tagged with 10 bp oligonucleotides for multiplexing Nextera™ DNA Sample Prep Kit (Illumina®-Compatible ...
-
bioRxiv - Microbiology 2019Quote: ... qPCRs were performed in an Eco RT-PCR system (Illumina). Relative quantification of gene expression was determined by the 2−ΔΔCt method [25] applied with software conforming to minimum information for publication of RT-qPCR experiments (MIQE ...
-
bioRxiv - Immunology 2019Quote: ... Libraries were prepared in parallel using the same number of PCR cycles and sequenced in parallel using a 150+150 bp NextSeq (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: ... The samples were barcoded and pooled in sets of eight per run to generate paired 150-bp reads with NextSeq 550 Sequencing System (Illumina), generating 21.2 - 118.8 million reads per sample ...
-
bioRxiv - Genomics 2020Quote: ... a PCR titration was performed prior to the production PCR (using Illumina primers PE1.0 and PE2.0). Primers were separated from the final library by size selection with AMpure XP (1:1 ratio ...
-
bioRxiv - Microbiology 2020Quote: ... and TruSeq Index PCR Primer barcodes (Illumina, San Diego, CA, USA) were used to prepare and index each individual library ...
-
bioRxiv - Immunology 2021Quote: ... and indexed TruSeq Small RNA PCR primers (Illumina, San Diego, CA) as specified(Stoeckius et al. ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: ... and indexed TruSeq Small RNA PCR primers (Illumina, San Diego, CA) as specified(13) ...
-
bioRxiv - Systems Biology 2021Quote: ... and libraries were amplified by PCR with barcoded Nextera primers (Illumina) using 2X NEBNext High-Fidelity PCR Master Mix (NEB) ...
-
bioRxiv - Cancer Biology 2022Quote: ... purified PCR products were amplified using indexed adapter primers from Illumina to generate barcoded amplicons and NEBNext Ultra II Q5 Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCRs were performed using index primers (NEBNext multiplex oligos for Illumina, set 1 ...
-
bioRxiv - Molecular Biology 2022Quote: Cell lysate was PCR amplified with genomic primers flanked by Illumina adaptor overhang to generate approximately 300 base products ...
-
bioRxiv - Molecular Biology 2023Quote: ... Library fragments were amplified using standard PCR and Nextera primers (Illumina) by adding 25 μl of 2x NEBnext master mix ...
-
bioRxiv - Genomics 2019Quote: ... 1μL SR RT Primer and following the manufacturers protocol (NEB small RNA for Illumina library prep); “Hybridize the reverse transcription primer” followed by “ligate 5’ SR adaptor…” ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Linker-ligated RNA was then incubated with RT Primer (TruSeq Small RNA Library Prep Kit, Illumina) and reverse transcription was performed with Superscript III RT (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Immunology 2022Quote: ... cDNA libraries were amplified 12 cycles of PCR with Terra PCR Direct polymerase Mix in the presence of i5 or i7 PCR primers (Illumina) to add sample specific indexes ...
-
bioRxiv - Genomics 2021Quote: ... Illumina adapter ligation and PCR The TruSeq DNA LT kit Set A (Illumina, #15041757) was used ...
-
bioRxiv - Immunology 2021Quote: ... and amplified for 12 cycles using the SI-PCR forward primer (10x Genomics) and a Nextera i7 reverse primer (Illumina). For the HTO-containing fraction ...
-
bioRxiv - Neuroscience 2022Quote: ... and finally converted into DNA libraries using custom rpi primers (RNA PCR Primer Index) adapted from the Truseq Small RNA kit (Illumina)106 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and amplified for 12 cycles using the SI-PCR forward primer (10x Genomics) and a Nextera i7 reverse primer (Illumina). For the HTO-containing fraction ...
-
bioRxiv - Microbiology 2019Quote: ... containing 5µL of each index primer (Nextera XT Index kit v2 set A, B and D; Illumina, San Diego, CA), 10ul of purified PCR products (0-20ng/µL ...
-
bioRxiv - Molecular Biology 2022Quote: ... MCF7 and BT-474 libraries were independently amplified with index primers N7xx and S5xx of Nextera XT Index Kit v2 Set A (FC-131-2001, Illumina) and Nextera XT Index Kit v2 Set B (FC-131-2002 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Bacterial 16S rRNA amplicons were constructed via amplification of the V4 region of the 16S rRNA gene with the universal primer set (U515F/806R) and flanked by Illumina standard adapter sequences as in a method previously described elsewhere33,34 ...
-
bioRxiv - Microbiology 2023Quote: ... One microliter of each eluted sample was used in polymerase chain reaction amplification of the variable region 4 of bacterial and archaeal 16S ribosomal RNA genes with barcoding primer set 515/806 based on the original Earth Microbiome Project protocol (Caporaso et al. 2011; “16S Illumina Amplicon ProtocolL ...
-
bioRxiv - Microbiology 2023Quote: ... amplified with the prokaryotic universal primer sets encoding F515/R806 47 were sequenced on a NovaSeq 6000 platform (Illumina, CA) at Novogene Co ...
-
bioRxiv - Microbiology 2024Quote: ... Variant type was confirmed in a subset of samples with available nasopharyngeal swabs by SARS-CoV-2 complete genome next-generation sequencing using Artic v5.3.2 (IDT, Coralville, IA) and Artic v4.1 primer sets (Illumina, San Diego, CA).
-
bioRxiv - Immunology 2020Quote: ... A second PCR was performed with Nextera® XT Index Kit v2 Set A (Illumina) to complete the adapter and add a unique sample-specific barcodes ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR was conducted using Eco Real-Time PCR (Illumina, CA, USA). The PCR mixture included 10 µl 2× Realtime PCR mix (Biofact ...
-
bioRxiv - Genetics 2019Quote: ... An indexing PCR was performed next using Nextera XT index kit primers (Illumina) and NEBNext High-Fidelity 2X PCR Master Mix (NEB ...
-
bioRxiv - Immunology 2022Quote: ... tagmented cDNA was amplified with Nextera PCR Mastermix containing Nextera i5 primer (Illumina), and custom i7 primer mix ...
-
bioRxiv - Neuroscience 2022Quote: ... 9-cycle PCR were performed using indexed primers from Nextera Index Kit (Illumina) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... and submitted to an additional 10 rounds of PCR with indexing primers (Illumina). The resulting libraries were pooled by volume with specimens at 100x the positive controls ...
-
bioRxiv - Molecular Biology 2023Quote: ... First-round PCR primers contained adapter sequence for DNA/RNA UD Indexes (Illumina). The second round of PCR and pooling of samples was performed according to the Illumina Nextera DNA library prep guide ...
-
bioRxiv - Microbiology 2023Quote: ... Secondary PCR was performed with forward and reverse primer sequences designated by Illumina. The thermal condition was set to be the same as the first PCR but for 8 cycles ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1.25 μM i5 and i7 PCR primers (Nextera® Index Kit (Illumina)) with the following PCR amplification conditions ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse primers contained i7 indexes from the TruSeq DNA PCR Free kit (Illumina). PCR reactions were run on agarose gels to verify amplification ...
-
bioRxiv - Microbiology 2022Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermalcycler with the following program ...
-
bioRxiv - Genetics 2023Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with partial adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermal cycler with the following program ...
-
bioRxiv - Systems Biology 2023Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermocycler with the following program ...