Labshake search
Citations for Illumina :
1 - 50 of 2347 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... The DNA fragments around the crRNA target site were amplified by a two-step PCR with specific primer sets (Table S2) and Index PCR Primers mentioned in the manufacturer’s instructions (Illumina, USA). After gel purification ...
-
bioRxiv - Systems Biology 2019Quote: ... and indexed with ScriptSeq™ Index PCR primers set 1 (Epicentre, Illumina) following the standard protocol ...
-
bioRxiv - Genomics 2023Quote: ... PCRs were performed using index primers (NEBNext multiplex oligos for Illumina, set 1, E7335) and amplified to linear phase ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCRs were performed using index primers (NEBNext Multiplex Oligos for Illumina - Set 1. Catalogue no. E7335) and amplified to linear phase ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCRs were performed using index primers (NEBNext Multiplex Oligos for Illumina - Set 1. Catalogue no. E7335) and amplified to linear phase ...
-
bioRxiv - Developmental Biology 2022Quote: ... and set up for the index PCR with Nextera XT index primers (Illumina, San Diego, CA). The indexed samples were purified using AMPure XP beads ...
-
bioRxiv - Microbiology 2020Quote: ... with RT primers (as recommended by Illumina). cDNAs were amplified with pfx DNA polymerase (Invitrogen ...
-
bioRxiv - Genetics 2021Quote: ... A second PCR step was run to add the index primers for sequencing (NEBNext Multiplex Oligos for Illumina Dual Index Primers Set 1 and 2). PCR products were purified using SPRIselect beads (Beckman ...
-
bioRxiv - Cell Biology 2022Quote: ... a PCR enrichment step was performed (8 cycles) using unique primer pairs for each library (NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1).
-
bioRxiv - Microbiology 2021Quote: The second stage PCR procedure attached unique index primers to each sample using the Nextera XT v2 set A kit (Illumina). Purified DNA (5 μl ...
-
bioRxiv - Genetics 2020Quote: Nextera barcode adapters were added to can1 amplicons and were then minimally PCR amplified (8 cycles) for attachment of Illumina Nextera XT index primers set A (Illumina). After PCR ...
-
bioRxiv - Plant Biology 2024Quote: ... and amplified in series of three PCR reactions with specific primers (1st PCR: only TSO_n1, 2nd PCR: TSO_n2 and CARMA_5RACE, 3rd PCR: Illumina indexing primers) and Phusion polymerase ...
-
bioRxiv - Molecular Biology 2019Quote: ... a shorter region of 178 bp (Fwh1 primer set with Illumina Nextera tails ...
-
bioRxiv - Genomics 2020Quote: ... and TruPE PCR primers (Illumina), then the amplified DNA was cleaned twice using 1.8X volume of SPRI beads ...
-
bioRxiv - Neuroscience 2023Quote: ... 5µL PCR Primer Cocktail (Illumina), 25µL NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.5 µL of universal primer and 0.5 µL of index primer (each at 0.5µM concentration; NEBNext multiplex oligos for Illumina index primers set 1 E7335). This mix has been amplified for 15 cycles (same amplification conditions as before) ...
-
bioRxiv - Genomics 2023Quote: ... a set of recently de novo-assembled libraries (Illumina NovaSeq 150 bp PE), from needle tissue of six individuals from a single half-sib family from Shadow Lake 39 ...
-
bioRxiv - Genetics 2022Quote: ... followed by attachment of Illumina Nextera XT index primers set A (Illumina). Excess adapters were removed using Ampure XP beads (Beckman Coulter) ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... (b) after index annealing with the Illumina indexing primer set (Illumina, #20020492), 12 PCR cycles were used for cDNA amplification ...
-
bioRxiv - Genomics 2019Quote: ... The SR RT primer (NEB small RNA kit for Illumina) was hybridized to the 3’ adapter and the 5’ adapter ligated by adding 2μL T4 RNA ligase buffer (NEB) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 6-digit index primers (Illumina RNA PCR Index Primers RPI1-RPI28) were used instead of 10-digit index primers suggested by the LM-Seq protocol ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of Index primer (both provided in NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2), and 25 μl NEBNext Ultra II Q5 Master Mix (PCR cycling conditions ...
-
bioRxiv - Genetics 2022Quote: ... The second PCR primer pair (Illumina_seqPCR) was used to attach Illumina adaptors and to barcode samples ...
-
bioRxiv - Genomics 2022Quote: ... the ScriptSeq™ Index PCR Primers (Sets 1 to 4) and the FailSafe™ PCR enzyme system (all sourced from Epicentre®/Illumina® Inc., Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Zoology 2022Quote: ... Twelve 150 bp paired-end libraries (six for the Mamm01 primer set and six for the MiFish-U primer set) were prepared with an Illumina TruSeq DNA PCR-free LT Sample Prep kit (Illumina, San Diego, California), spiked with 8% phiX ...
-
bioRxiv - Genomics 2019Quote: ... and reverse transcribed using 25 pmol RT primer (5’-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3’) for TRU-seq barcodes (RP1 primer, Illumina). A portion of the RT product was removed and used for trial amplifications to determine the optimal number of PCR cycles ...
-
bioRxiv - Genomics 2023Quote: ... qPCRs were performed using index primers (NEBNext multiplex oligos for Illumina, set 1, E7335) and amplified to linear phase (3-5 PCR cycles).
-
bioRxiv - Genomics 2019Quote: ... with the exception that a two-step PCR was used for all reactions (first PCR using untailed primers, second PCR using Illumina adapter-tailed primers), even if a one-step PCR was used in the original protocol ...
-
bioRxiv - Physiology 2022Quote: ... and 1.0 μL of each index primer of the Nextera XT Index Kit v2 Set B and Set C (FC-131-2002, FC-131-2003; Illumina Inc., CA., USA.). The first step ...
-
bioRxiv - Genetics 2023Quote: ... dsODN specific PCR products were used for indexing PCR using 2x Platinum SuperFi PCR Master mix and i5 primer: AATGATACGGCGACCACCGAGATC and i7 indexing primers (Illumina) following the cycling conditions ...
-
bioRxiv - Microbiology 2023Quote: ... and subjected to a second PCR amplification with primer oTB537 (an Illumina sequencing primer) and a barcoding primer (unique for each sample to allow for demultiplexing of reads ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification was performed using Nextera primers (Illumina) to make the libraries for deep sequencing.
-
bioRxiv - Genetics 2021Quote: ... and a unique indexed RNA PCR primer (Illumina) per reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... and a unique indexed RNA PCR primer (Illumina) per reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a unique indexed RNA PCR primer (Illumina) per reaction ...
-
bioRxiv - Genetics 2023Quote: ... After adapter ligation (Illumina PE PCR 1.0 and PE PCR 2.0 primers), the bead-bound Hi-C DNA was amplified with seven PCR amplification cycles ...
-
bioRxiv - Cell Biology 2023Quote: The PCR primers introduce the full-length adaptor sequence required for Illumina sequencing (for details see Illumina small RNA PCR primers). PCR was performed in 12.5 μL using half of the ranhexRT sample as a template [1× KAPA HiFi HotStart ReadyMix (KapaBiosystems KK2602) ...
-
bioRxiv - Plant Biology 2024Quote: ... After three rounds of PCR with specific primers (1stPCR: CARMA_3RACE and RTPXT, 2ndPCR: mXTf and mXTr, 3rd PCR: Illumina indexing primers) and cleaning each PCR reaction on AMPure beads ...
-
bioRxiv - Microbiology 2023Quote: The influenza genome was amplified from RNA extracted from virus isolates using a multi-segment RT-PCR with universal primers (39, 40) and sequenced using Nextera DNA library preparation and MiSeq (PE300) sequencer (Illumina, San Diego, CA, USA), as previously described (13) ...
-
bioRxiv - Plant Biology 2021Quote: ... 10 ng of template DNA and index primer 1 (N7xx) and index primer 2 (N5xx) of Nextera XT Index Kit v2 Set A (Illumina, San Diego, CA, USA) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: ... from islets was added to 50 μM first-strand RT primer (the sequence at the 5’ portion corresponds to primer P7 on the Illumina flowcell), 10 mM dNTP mix ...
-
bioRxiv - Genetics 2020Quote: ... The first PCR used universal primers (without Illumina indexes) to amplify the barcodes ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR amplification using Illumina sequencing adaptor primers (Illumina). Paired-end sequencing was performed on a Hi-Seq 2500 System (University of Georgia Genomics Core ...
-
bioRxiv - Neuroscience 2019Quote: ... the amplification (cDNA and PCR) and sequencing primers (Illumina) and the low-quality bases were removed using Trimmomatic 0.35 software 63 ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse and forward amplicon PCR primers recommended by Illumina were used (16s Amplicon PCR Forward Primer= TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG ...
-
bioRxiv - Genetics 2023Quote: ... using PCR primers ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAGAAGCAGCTCGACGC and GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGCTGCCGGAAGTGCT (Illumina adapters underlined) and Phire DNA polymerase (Thermofisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1 μl of each Nextera XT Index Kit v2 set B or set C barcoding primer (Illumina, Cat# FC-131-2002 or FC-131-2003). These reactions were then incubated at 95°C for 15 minutes ...
-
bioRxiv - Genomics 2020Quote: ... Transcript evidence was derived from 25 RNA-seq read sets (BioProject PRJNA450098, Illumina 2500, 150 bp paired-end) using StringTie v1.3.3b (Pertea et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... The libraries were sequenced on a Hiseq X-ten instrument set for paired-end 150 bp sequencing (Illumina).