Labshake search
Citations for Illumina :
201 - 250 of 292 citations for SARS Coronavirus Spike Glycoprotein S1 Mosaic N Term E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... using a Pipin prep (Sage Science, Beverly, MA, USA) and sequenced using S1 chemistry (paired-end, 2×50 bp sequencing) on a Novaseq sequencer (Illumina, Cambridge, UK). 2 biological replicates were analysed per condition.
-
bioRxiv - Genetics 2021Quote: ... and prepared bar-coded cDNA libraries for sequencing on an S1 flow cell on the NovaSeq 6000 platform (Illumina, San Diego, CA) as described previously21.
-
bioRxiv - Genomics 2022Quote: ... The construction of libraries was performed with Illumina preparation kits (Table S1) following the manufacturer’s recommendations (Illumina Inc., San Diego, CA, USA). The Nextera DNA Prep kit and Illumina DNA Prep were used for WGS ...
-
bioRxiv - Microbiology 2022Quote: Amplicon libraries were prepared according to (16) using published 16S and 18S rRNA gene primers (Table S1) and by sequencing via the MiSeq platform (Illumina Inc., USA). Raw sequence reads were processed following a bioinformatic pipeline in Deng et al ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed on an Illumina NovaSeq 6000 instrument using the NovaSeq 6000 S1 Reagent Kit v1.5 (200 cycles) (Illumina, cat. no. 20028317), in a pair-end 2x100 cycle mode ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli transposition assays were mixed with 5 µL of tagmentation DNA buffer (Illumina) and 1 µL of amplicon tagmentation mix (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike in (PhiX Control v3 Illumina Catalogue FC-110-3001). Whole genome sequencing data has been deposited in the Sequence Read Archive under PRJNA529870.
-
bioRxiv - Microbiology 2020Quote: ... ChIP-seq libraries were sequenced on the Illumina NextSeq 500 system with a 20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Genomics 2019Quote: ... paired-end mode with R1 67 and R2 8) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... PhiX Control v3 adapter-ligated library (Illumina p/n FC110-3001) was spiked-in at 1% by weight to ensure balanced diversity and to monitor clustering and sequencing performance ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina ...
-
bioRxiv - Genomics 2020Quote: ... Deep- and shallow-sequence libraries were pooled separately and sequenced on either Illumina HiSeq 2500 or HiSeq 4000 (Table S1, Illumina, San Diego, CA).
-
bioRxiv - Evolutionary Biology 2022Quote: ... We sent 100 ng of DNA from 289 sapsuckers (Supplemental Materials Table 1) to Genome Quebec for sequencing on either an Illumina HiSeq4000 PE150 or the NovaSeqSP 6000 PE150 (Table S1) (Illumina, San Diego, CA).
-
bioRxiv - Genomics 2021Quote: The full-coding region of 48 CRC-related genes (Supplementary Table S1) was sequenced using a MiSeq platform (Illumina, San Diego, CA, USA) on a subset of 44 unpaired tumor samples ...
-
bioRxiv - Neuroscience 2021Quote: ... The 3’ gene expression libraries and HTO sequencing libraries were pooled and sequenced at an approximate depth of 50,000 reads per cell for the 3’ gene expression libraries and 5,000 reads for HTO libraries using the NovaSeq S1 (Illumina, San Diego, CA, USA) flow cells.
-
bioRxiv - Cell Biology 2023Quote: ... Editing frequencies in samples collected following transplantation were assessed via deep sequencing of PCR amplified libraries of the CD33 gRNA target region (Table S1) on an Illumina Miseq (Illumina, San Diego, CA) via 300bp paired end reads and a median sequencing depth of 100,000 reads/gRNA target site ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed using Pair-end 2×100 cycle mode on the Illumina NovaSeq 6000 system (NovaSeq 6000 S1 Reagent Kit v1.5 200 cycles Illumina, cat. no. 20028317; 0.5% of the PhiX control library, Illumina, cat. no. FC-110-3001) and the standard clustering procedure.
-
bioRxiv - Molecular Biology 2021Quote: ... coli control sample was rRNA depleted using the RiboZero for bacteria kit (Illumina, USA). 100 ng of two replicates each of AbmR co-purified RNA and rRNA-depleted induced E.coli control RNA were converted into RNA-seq libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... At Gdansk two independent protocols were used for SARS-CoV-2 genome sequencing: Illumina RNA prep with enrichment for respiratory virus oligos panel V2 followed by Illumina MiniSeq medium output run that produced 150-nucleotide paired-end reads ...
-
bioRxiv - Systems Biology 2019Quote: ... denatured in NaOH and combined with HT1 plus a 1% PhiX spike at a final running concentration of 10pM.The flow-cell was clustered using HiSeq PE Cluster Kit v3 (Illumina, PE-401-3001) utilising the Illumina PE HiSeq Cluster Kit V3 cBot recipe V8.0 method on the Illumina cBot ...
-
bioRxiv - Genomics 2020Quote: ... 10 pM DNA library was prepared under Denature and Dilute Libraries Guide of Illumine MiSeq System with 15% PhiX spike-in control (Illumina, CA, USA) and eventually subjected to 250 bp pair-end sequencing on a MiSeq lane (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were multiplexed and sequenced with a 15% spike-in of PhiX DNA in an Illumina NovaSeq platform (Illumina, San Diego, CA) using a 200 cycle single-end read at the same facility ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... trim regions with average quality scores below Q10 from both ends of reads and to filter out reads aligning to PhiX-174 genome (a commonly used spike-in control in Illumina sequencing runs). After filtering ...
-
bioRxiv - Genomics 2019Quote: ... libraries were prepared according to the manufacturer’s instructions with a 1% spike-in of the ϕX174 control library (Illumina #FC-110-3002) and sequenced on an Illumina NextSeq 500 instrument with a High Output v2 reagent kit (Illumina #FC-404-2005) ...
-
bioRxiv - Genomics 2021Quote: ... using the Illumina TruSeq mRNA library preparation protocol (poly-A selected) (Illumina; Part: 15031047 Revision E). mRNA-Seq libraries were sequenced on an Illumina NovaSeq 6000 platform to generate >66 M paired end reads per sample (Min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We confirmed all strains had marker-less deletions by PCR followed by Sanger sequencing (primers given in Table S1) and Next Generation Sequencing (Illumina HiSeq PE150, >30x coverage). We used P1 transduction to transfer modifying enzyme (ME ...
-
bioRxiv - Microbiology 2023Quote: DNA samples were sent for amplicon sequencing of the V6-V8 16S rRNA region using staggered primers (Table S1) by the Genome Quebec Innovation Centre using an Illumina MiSeq platform (Illumina Inc., San Diego, CA) and analyzed using an established QIIME 2 pipeline (21 ...
-
bioRxiv - Immunology 2022Quote: ... a multiplexed amplicon-based whole-viral-genome approach using the NEBNext® ARTIC SARS-CoV-2 Library Prep Kit (Illumina®) was employed (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... Library preparation of amplified SARS-CoV-2 DNA for sequencing was performed using a Nextera XT library prep kit (Illumina Inc.) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Library preparation of amplified SARS-CoV-2 DNA for sequencing was performed using a Nextera XT library prep kit (Illumina Inc.) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... DNA fragments of the SARS CoV-2 genome were hybridized with biotinylated respiratory virus oligos (Illumina Inc., San Diego, CA, USA). The DNA fragments hybridized with the custom oligos were captured using streptavidin magnetic beads ...
-
bioRxiv - Genomics 2020Quote: Messenger RNA capture based libraries were prepared starting from 8.5 µL DNase treated and spike-in supplemented RNA eluate using the TruSeq RNA Exome Library Prep Kit (Illumina, San Diego, CA, USA). Each sample underwent individual enrichment according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... libraries were prepared according to the manufacturer’s instructions with a 1% ϕX174 spike-in and sequenced on an Illumina MiSeq instrument with a Reagent Kit v3 (Illumina #MS-102-3001), reading 169 nt for read 1 and 6 nt for the P7 index read.
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced on Illumina next-generation sequencing platforms with a 20% spike-in of PhiX control DNA (Illumina, cat. no. FC-110-3001). All sequencing runs used a dual-index configuration and a custom Read 1 primer (5’ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAG 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... Purified libraries were sequenced on Illumina MiSeq platform (reagent kits: v2 300-cycles, paired-end mode) at 8 pM loading concentration with 25% PhiX spike-in (Illumina FC-110-3001). Custom sequencing primers were spiked into reagent cartridge (well 12 ...
-
bioRxiv - Systems Biology 2023Quote: ChIP-seq and input libraries were sequenced on the Illumina NextSeq 500 system with a ∼20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Microbiology 2023Quote: ... (Text S1.), while sequencing was performed at the Swedish National Genomics Infrastructure (NGI) (Uppsala, Sweden) on Illumina MiSeq platform (Illumina Inc, San Diego, CA, USA) in a 2×300 bp paired-end format and with v3 chemistry.
-
bioRxiv - Immunology 2021Quote: ... commercial reagents were used for unique dual indexed amplicon library generation according to the Artic protocol (NEBNext® ARTIC SARS-CoV-2 Library Prep Kit (Illumina®)) ...
-
bioRxiv - Microbiology 2022Quote: ... and variant calling as described by the software manufacturer (https://help.geneious.com/hc/en-us/articles/360045070991-Assembly-of-SARS-CoV-2-genomes-from-tiled-amplicon-Illumina-sequencing-using-Geneious-Prime). For each sample ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was amplified using ARTIC v4 primer pools (https://github.com/artic-network/artic-ncov2019) and variant calling results were generated using the SIGNAL (SARS-CoV-2 Illumina GeNome Assembly Line) pipeline v1.5.0 42 ...
-
bioRxiv - Immunology 2019Quote: ... The eight capture pools were then pooled equimolar and sequenced across two Illumina HiSeq2500 v2 150bp single-end rapid lanes with a ten percent PhiX control library spike (Illumina Inc., San Diego, CA). Basecall files (bclfiles ...
-
bioRxiv - Genomics 2020Quote: Small RNA libraries were prepared starting from 5 µL DNase treated and spike-in supplemented RNA eluate using a TruSeq Small RNA Library Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol with two minor modifications(1) ...
-
bioRxiv - Genomics 2021Quote: ... Illumina Catalogue FC-404-2003) following the Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike (PhiX Control v3 Illumina Catalogue FC-110-3001).
-
bioRxiv - Genomics 2022Quote: ... Illumina Catalogue FC-404-2003) following the Illumina recommended denaturation and loading recommendations which included a 1 % PhiX spike in (PhiX Control v3 Illumina Catalogue FC-110-3001). Data was uploaded to Basespace (www.basespace.illumina.com ...
-
bioRxiv - Microbiology 2023Quote: ... The library was then diluted to a concentration of 15 pM and sequenced with a 15% PhiX spike-in on an Illumina MiSeq sequencing platform using the MiSeq Reagent Kit v3 (600 cycles) (Illumina, Inc., San Diego, CA). The resulting read lengths were 301 bp (forward sequences) ...
-
bioRxiv - Immunology 2024Quote: ... The libraries were then pooled at 5nM and sequenced on an Illumina NextSeq 2000 instrument at a 600pM input and 2% PhiX spike in using a P3 100 cycle flow cell (Illumina, San Diego, CA, USA) resulting in 36000-58000 reads per cell.
-
bioRxiv - Neuroscience 2020Quote: ... The TruSeq RNA Sample Preparation Kit (Illumina, Cat. N°RS-122-2002, USA) was used for library preparation (1 µg total RNA) ...
-
bioRxiv - Genetics 2020Quote: ... bovis (n=84 genotyped animals retained after quality control of the Illumina reads). Controls were animals which were lesion and culture negative for M ...
-
bioRxiv - Genetics 2020Quote: ... bovis (n=128 genotyped animals retained after quality control of the Illumina reads). An additional Fulani animal was also genotyped but we did not have any information on its M ...
-
bioRxiv - Microbiology 2023Quote: ... coli isolate was pooled together and sequenced on an Illumina MiSeq platform (Illumina, San Diego, CA) using 2 x 250 or 2 x 300 paired-end approach ...