Labshake search
Citations for Illumina :
651 - 700 of 2106 citations for SARS CoV 2 Spike N Terminal Domain NTD Sheep Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... The cell pellet was resuspended with 50 μl transposition mix containing 25 μl 2X TD buffer (Illumina FC-121-1030), 3.5 μl Tn5 transposase (Illumina FC-121-1030) ...
-
bioRxiv - Genomics 2021Quote: ... The nuclei-enriched pellet was immediately used for transposition reaction using Nextera DNA Library Prep Kit (Illumina, FC-121-1030). The transposition reaction was incubated at 370C for 30 min and followed immediately by purification using QIAGEN MinElute Kit (Qiagen ...
-
bioRxiv - Neuroscience 2019Quote: ... NGS libraries were prepared using 150 pg of cDNA input and the Nextera XT DNA Library Preparation Kit (catalog FC-131-1024, Illumina) with 11 cycles of PCR ...
-
bioRxiv - Plant Biology 2020Quote: ... Nuclei pellets were collected as described previously by centrifugation at 1,000 × g and tagmented with Nextera DNA Library Prep Kit (Illumina, catalog number: FC-121-1030, now discontinued; replacement can be found as Illumina Tagment DNA TDE1 Enzyme and Buffer Kits ...
-
bioRxiv - Genomics 2022Quote: ... A paired-end library was prepared with the TruSeq DNA PCR-Free LT Sample Preparation Kit (Illumina, #FC-121-3001) from 1 µg of the genomic DNA ...
-
bioRxiv - Microbiology 2022Quote: ... MS-103-2003) at a concentration of 15nM with the addition of 15% Phix Control v3 (Illumina, FC-11-2003) described by Chaudhry et al ...
-
bioRxiv - Neuroscience 2021Quote: ... ~600 pg of purified cDNA was used to produce a RNA-seq library using Nextera XT DNA Library Preparation kit (FC-131-1024, Illumina), following the manufacturer instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... tagmentation was carried out on double-stranded cDNA using the Nextera XT Library Sample Preparation kit (Illumina, FC-131-1096). Each well was mixed with 0.8 µl Nextera tagmentation DNA buffer (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... 100ng of full-lentgth cDNAs are used as input to the Nextera DNA Sample Prep kit (ref FC-121-1030, Illumina) which enriches for 3′ends of cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The sequencing library was prepared using the Illumina TruSeq RNA Sample Prep Kit (FC-122-1001; Illumina, San Diego, CA) with 1 ug of total RNA ...
-
bioRxiv - Cancer Biology 2022Quote: Sequencing libraries were constructed from the cDNA using the Illumina Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). The cDNA library was sequenced on the NovaSeq 6000 instrument using 150-bp paired-end reads.
-
bioRxiv - Developmental Biology 2022Quote: ... RNA-seq libraries were sequenced for 75 cycles in single-end mode on NextSeq 500 platform (Illumina, FC-404-2005).
-
bioRxiv - Cell Biology 2019Quote: Purified cDNA (75 ng) was used as input to the Nextera XT DNA library preparation kit (Illumina, FC-131- 1096), following the manufacturers protocol with the modification of using 1:5 of reagent volumes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were pooled and tagmentation performed using the Illumina Nextera XT DNA sample preparation kit (Illumina Cat #FC-131-1024), libraries pooled and sequenced on a HiSeq 2000.
-
bioRxiv - Genetics 2019Quote: ... Samples were sequenced using 2×75bp paired-end with the NextSeq 500/550 Mid Output v2 kit (150 cycles; Cat. No. FC-404-2001) on an Illumina NextSeq500 Sequencer (Illumina). Sequencing was performed by the Genome Research Hub at Cardiff University ...
-
bioRxiv - Genomics 2019Quote: Single cell calling card library preparation was performed using the Nextera Mate Pair Sample Prep Kit (Illumina #FC-132-1001) with modifications to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: Calling card libraries from bulk RNA were generated using the Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1024). One nanogram of PCR product was resuspended in 5 µl ddH2O ...
-
bioRxiv - Genetics 2020Quote: ... Transposition reaction was performed according the manufacturer’s protocol for Nextra Tn5 transpoase Nextra kit (Illumina, Cat. No.: FC-121-1030). Transposed DNA fragments were purified by Qiagen MiniElute PCR purification kit (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and mate-pair libraries of 3 kb and 6 kb insert sizes were prepared using the Nextera Mate Pair Sample Preparation Kit (cat. No. FC-132-1001, Illumina). We then assessed library quality using the HS DNA Kit (Agilent ...
-
bioRxiv - Genomics 2021Quote: ... and each sample was uniquely indexed using Nextera XT Index Kit V2 indexing primers (Illumina, Cat. No. FC-131-2001). Indexed libraries were purified with Omega Mag-Bind Total Pure NGS Beads ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and mate-pair libraries of 3 kb insert size were prepared using the Nextera Mate Pair Sample Preparation Kit (cat. No. FC-132-1001, Illumina). We then assessed library quality using the HS DNA Kit (Agilent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Approximately 30% of Illumina libraries were constructed in-house with the Nextera DNA Library Preparation Kit (Illumina, FC-121-1030) using a protocol based off of previously published protocols51,52 ...
-
bioRxiv - Microbiology 2020Quote: ... Dual-indexed sequencing libraries were prepared from the lysates using Nextera XT DNA Library Preparation Kit (Illumina FC-131-1096), and sequenced on an Illumina Miseq benchtop sequencer (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... Sequencing was carried out by running 150 cycles on Illumina HiSeq 2500 using TruSeq Rapid SBS Kit (FC-402-4001, Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... Pooled libraries were sequenced using the NextSeq 500/550 High Output Kit v2 for 75 cycles (Illumina FC-404-2005). Base calling accuracy was greater than 80% (>=Q30 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Sequencing libraries were prepared from 1µg DNA using the TruSeq PCRfree DNA sample preparation kit (cat# FC-121-3001/3002, Illumina Inc.) targeting an insert size of 350bp ...
-
bioRxiv - Genomics 2021Quote: ... The 20 ul preamp was then mixed with 25 ul TD buffer and 5 ul TDE1 buffer (Nextera kit, FC-131-1096, Illumina) and incubated for 5 min at 55 C and held at 10 C ...
-
bioRxiv - Developmental Biology 2022Quote: ... using the NextSeq® 500/550 High Output Kits v2 (75 cycles; single-end sequencing; Cat# FC-404-2005, Illumina). The FASTQ files were processed using the DolphinNext pipeline 36 on the Massachusetts Green High Performance Computer Cluster (GHPCC) ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR-amplified sequencing libraries were prepared from 100ng DNA using the TruSeq Nano DNA sample preparation kit (cat# FC-121-4001/4002, Illumina) targeting an insert size of 350bp ...
-
bioRxiv - Cancer Biology 2022Quote: ... HiSeq PE Rapid Cluster Kit v2 (PE-402-4002, Ilumina) and HiSeq Rapid SBS Kit v2 (200 cycles) (FC-402-4021, Illumina). Sequencing was performed on the MiSeq and HiSeq2500 Illumina sequencing platforms ...
-
bioRxiv - Neuroscience 2023Quote: ... R2: 75) sequencing of approximately 40 million reads per sample using the High Output v2 kit (FC-404-2002, Illumina) on a NextSeq550 following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... of libraries were pooled and subjected to paired-end (R1: 26, R2: 50) sequencing using the High Output v2 kit (FC-404-2002, Illumina) on a NextSeq550 following the manufacturer’s instructions.
-
bioRxiv - Genomics 2022Quote: Tn5 integration was performed as previously published 90 on purified nuclei using the Nextera Illumina kit (Illumina, FC 121 1031) at 37 °C for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Each pool was sequenced on the Illumina NextSeq 500 after the addition of 5% PhiX sequencing control library (FC-110-3002; Illumina) using the following settings ...
-
bioRxiv - Molecular Biology 2022Quote: ... MCF7 and BT-474 libraries were independently amplified with index primers N7xx and S5xx of Nextera XT Index Kit v2 Set A (FC-131-2001, Illumina) and Nextera XT Index Kit v2 Set B (FC-131-2002 ...
-
bioRxiv - Molecular Biology 2023Quote: ATAC-seq was performed based on published protocols 83 using reagents from a Nextera sequencing kit (Illumina, FC-121-1030). Cells were detached using TrypLE Express (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: Selected FLIPS proviral amplicons underwent NGS library preparation using the Nextera XT DNA Library Preparation Kit (Illumina, #FC-131-1096) with indexing of 96-samples per run according to the manufacturer’s instructions (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... The nuclei was resuspended in the transposition reaction mix containing 25 μL 2x TD Buffer (Illumina, cat #FC-121-1030), 2.5 μL Tn5 Transposase (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... The PhiX Control library was spiked in the sequencing sample at 10% (v/v) (Illumina, cat. no. FC-110-3001).
-
bioRxiv - Immunology 2023Quote: ... Paired-end sequencing libraries were prepared from amplified cDNA with the Nextera XT DNA sample Prep Kit (Illumina, #FC-131) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... in single-end mode using the NextSeq 500/550 High Output Kit (75 Cycles) (Illumina, cat. no. FC-404-2005) except for scCUTseq libraries from brain and skeletal muscle ...
-
bioRxiv - Physiology 2023Quote: ... mRNA-Seq libraries were then prepared using the Illumina Nextera XT DNA Library Preparation kit (Illumina Cat # FC-131-1024). 1 ng of cDNA was used as input and 12 amplification cycles were used during PCR enrichment ...
-
bioRxiv - Pathology 2024Quote: ... and 2ng of each sample was used to construct a pool of uniquely indexed samples (Illumina Cat# FC- 131-1096). A second amplification was performed with 12 cycles and cleaned up with AMPure XP beads ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries for sequencing were prepared from 600pg cDNA input using Nextera XT library preparation kit (Illumina, Cat: FC-131-1096) with i7 primers from Illumina (N70X ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... sequencing libraries were prepared from 1μg DNA using the TruSeq PCRfree DNA sample preparation kit (cat# FC-121-3001/3002, Illumina Inc.). The library preparation was performed according to the manufacturers’ instructions (guide#15036187).
-
bioRxiv - Neuroscience 2023Quote: ... mRNA-seq libraries were prepared using Smart-seq2 (Picelli et al., 2013) and a Nextera XT DNA Library Preparation kit (FC-131-1024, Illumina) following the protocol and the manufacturer’s instructions with minor modification ...
-
bioRxiv - Cancer Biology 2024Quote: Sequencing libraries were constructed from the cDNA using the Illumina Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). The cDNA library was sequenced on a NovaSeq 6000 instrument using 150-bp paired-end reads.
-
bioRxiv - Developmental Biology 2022Quote: ... 300pM of the pooled library was loaded onto a NovaSeq S1 flowcell (Illumina p/n 20012865), using the Standard Workflow loading conditions designated by the manufacturer and amplified by exclusion amplification (ExAMP ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Neuroscience 2019Quote: ... Index 2: 8 cycles) across 2 runs on a NextSeq 500 (Illumina) with an average read depth across biological replicates of 8,815 reads per cell.