Labshake search
Citations for Illumina :
501 - 550 of 2106 citations for SARS CoV 2 Spike N Terminal Domain NTD Sheep Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: Illumina sequencing libraries were prepared using the Nextera XT Library Sample Preparation kit (Illumina, FC-131-1096) (Darmanis et al. ...
-
bioRxiv - Microbiology 2020Quote: ... The final libraries were multiplexed and 20% (v/v) PhiX control DNA (Illumina, Catalog # FC-110-3001) per lane and were sequenced using an Illumina HiSeq 2500 Rapid Run (150 bp ...
-
bioRxiv - Immunology 2020Quote: ... a cDNA library was prepared using a TruSeq RNA sample preparation kit (Illumina cat. FC-122-1001) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Illumina sequencing libraries were prepared using the Nextera XT Library Sample Preparation kit (Illumina, FC-131-1096) (Darmanis et al. ...
-
bioRxiv - Physiology 2022Quote: The cDNA libraries were prepared using the Illumina NexteraXT DNA library prep kit (Illumina, #FC-131-1096) based on the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were sequenced using the NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Primary data analysis was performed with the Illumina RTA version 2.4.11 and base calling software version bcl2fastq-2.20.0.422.
-
bioRxiv - Cell Biology 2019Quote: ... Samples were sequenced using the NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Primary data analysis was performed with the Illumina RTA version 2.4.11 and base calling software version bcl2fastq-2.20.0.422.
-
bioRxiv - Microbiology 2019Quote: ... DNA sequencing libraries were prepared using the Nextera XT DNA Library Preparation Kit (Illumina, #FC-131-1096) and were sequenced on the Illumina NextSeq 500 platform as 150-nt paired-end reads ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were prepared following the instructions of the TruSeq DNA Sample Preparation Kit (Illumina, #FC-121-2001) and sequenced on the HiSeq 2500 and the Nextseq 500 (Illumina).
-
bioRxiv - Immunology 2021Quote: ... RNA-seq libraries were generated with the Nextera XT DNA Library Preparation kit (FC-131-1024, Illumina) and manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... and 22.5 μl nuclease-free water) (Nextera DNA Library Prep Kit (Illumina, cat. no. FC-121-1030). The transposase reaction was performed at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: The Illumina-specific adapters were added using the Illumina TruSeq Library Preparation Kit (Illumina, FC-121-3001) according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: Library preparation was performed using the Illumina Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). Libraries in each batch were multiplexed together so that every sequencing lane contained three samples ...
-
bioRxiv - Genetics 2020Quote: Illumina sequencing libraries were prepared using Nextera XT DNA Library Prep Kit (Illumina, cat# FC-131-1096). The concentrations of cDNA libraries were diluted to 0.1-0.3ng/ul ...
-
bioRxiv - Developmental Biology 2022Quote: ... using the NextSeq® 500/550 High Output Kits v2.5 (50 cycles; Cat# FC-404-2005, Illumina). The sequencing outputs were processed using the CellRanger software v3.1.0 on the Massachusetts Green High Performance Computer Cluster (GHPCC) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tagmentation and amplification was performed using Nextera XT DNA Library Preparation Kit (Illumina, cat #FC-131-1096) and 600 pg input of each sample ...
-
bioRxiv - Immunology 2022Quote: ... RNAseq libraries were prepared with the Nextera XT DNA Library Preparation Kit (cat# FC-131–1096, Illumina) and carrying out 8 PCR cycles ...
-
bioRxiv - Microbiology 2022Quote: ... We then used an adaptation of the Nextera Library Prep kit (Illumina, cat. FC-121-1030/1031) (73 ...
-
bioRxiv - Microbiology 2022Quote: ... The library was prepared using Nextera XT DNA Library Preparation kit (Lot No. FC-131-1096, Illumina) and sequencing was performed on an Illumina Novoseq 6000 platform.
-
bioRxiv - Neuroscience 2023Quote: ... Pellets were resuspended in transposase reaction mix (25 μL 2x TD Buffer (Illumina Cat #FC-121-1030) 2.5 μL Tn5 Transposase (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Neuroscience 2022Quote: ... and then sequenced Paired-End 101 bases using the HiSeq SBS Kit v4 (Illumina, FC-401-4003) on a HiSeq 2500 system ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 25 μl of 2x TD buffer and 2.5 μl tagmentation enzyme (Illumina transposase FC-121-1030). DNA was purified using a Qiagen mini elute kit following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The quantified library pool was diluted to 1 nM and sequenced on MiniSeq (Illumina, FC-420-1001) to check for the quality of reads ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The pellets were resuspended in the reaction buffer (25 μL TD Buffer (Illumina Cat #FC-121-1030), 2.5 μL Tn5 Transposes (Illumina Cat #FC-121-1030) ...
-
bioRxiv - Microbiology 2023Quote: ... which was performed using the Nextera XT library preparation kit (Illumina, FC-131-1096, San Diego, California) and then subsequent sequencing on the NovaSeq 6000 platform (1 x 100bp ...
-
bioRxiv - Developmental Biology 2023Quote: ... Library DNAs were prepared according to the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096) and sequenced by Illumina NextSeq 500 (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... The nuclei were resuspended in transposition reaction mix (2x TD Buffer (Illumina Cat #FC-121–1030, Nextera), 2.5 µl Tn5 Transposase (Illumina ...
-
bioRxiv - Bioengineering 2023Quote: ... The library was prepared using Nextera XT DNA library preparation kit (Illumina, cat no. FC-131-1096). For each setting ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclei were resuspended in 50 µl transposition reaction mix with Nextera Tn5 Transposase (Illumina, FC-121-1030) and incubated for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the pellet of nuclei was subjected to transposition with Nextera Tn5 transposase (Illumina #FC-121–1030) for 30 min at 37°C ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Cancer Biology 2020Quote: ... Antibody tag libraries were sequenced with an Illumina NextSeq 550 75-cycle High Output Kit (Illumina, cat. no. 20024906) in paired-end mode ...
-
bioRxiv - Microbiology 2023Quote: Raw FASTQ files provided by the GTF containing all reads and corresponding tags indicating whether they were accepted or filtered out according to the CASAVA 1.82 pipeline (Illumina). Only reads tagged as accepted were kept for further analysis ...
-
bioRxiv - Developmental Biology 2023Quote: 6hpf and 12hpf H2A.Z and Anp32e genomic localization data were collected using Epicypher CUT&Tag protocol and library generation followed by Illumina paired-end sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of six libraries of samples were pooled at 12 pM with 1% PhiX spike-in and paired-end sequenced with Illumina MiSeq system using Illumina MiSeq Reagent Kit v3 (150-cycle) (Illumina, United States, MS-102-3001). An average of 5.60 Gb data was obtained from 1849.27 K/mm2 mean cluster density in each sequencing run on MiSeq ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were pooled and sequenced on the Illumina NextSeq 500/550 High Output platform (Illumina, FC-404-2002) up to 18 samples per lane with 1% PhiX spike as a control.
-
bioRxiv - Genomics 2020Quote: ATAC-seq was performed as previously described using the Nextera DNA Library Prep Kit (Illumina #FC-121-1030). First ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were then transposed for 30’ at 37’C with adapter-loaded Nextera Tn5 (Illumina, Fc-121-1030). Transposed fragments were directly PCR amplified and sequenced on an Illumina NextSeq 500 to generate 2x 75bp paired-end reads.
-
bioRxiv - Evolutionary Biology 2020Quote: ... from 1 μg DNA using the TruSeq PCRfree DNA sample preparation kit (FC-121-3001/3002, Illumina Inc.) targeting an insert size of 350 bp as directed ...
-
bioRxiv - Neuroscience 2019Quote: ATAC-seq libraries were prepared using the Tn5 transposase system (Nextera DNA library kit, Illumina, FC-121–1030) as previously described (23) ...
-
bioRxiv - Bioengineering 2021Quote: ... 570 μL of denatured library DNA and 30 μL of denatured PhiX control library (Illumina, FC-110-3001) were mixed ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were then transposed for 30 min at 37C with adaptor-loaded Nextera Tn5 (Illumina, Fc-121-1030). Transposed fragments were directly PCR amplified and Sequenced on an Illumina NextSeq 500 platform to generate 2 x 36-bp paired-end reads.
-
bioRxiv - Neuroscience 2021Quote: ... Purified amplicons were prepared for sequencing using the Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1001) using 1 ng of purified amplicon library per sample ...
-
bioRxiv - Neuroscience 2020Quote: ... Full-length cDNA was then processed with a Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). This kit aims to fragment and add adapter sequences onto template DNA with a single tube Nextera XT tagmentation reaction and so generate multiplex sequencing libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-sequencing was performed using NextSeq75 High Output v2 kit and NextSeq 500 (Illumina; cat# FC-404-2005). Using TruSeq 3’ SE adaptor sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... A second PCR step was performed with Illumina Nextera XT Index Kit v2 (Illumina, Cat.:FC-131-2001) and Ex Taq DNA Polymerase (TaKaRa Bio ...