Labshake search
Citations for Illumina :
501 - 550 of 1006 citations for Recombinant Human Chemokine C X C Motif Ligand 10 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA sequencing was performed at BCM Human Genome Sequencing Center using NovaSeq 6000 platform (Illumina). The raw fastq files were first quality checked using FastQC v0.11.8 software (http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was performed with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted by the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genome-wide DNA methylation was analysed on 850000 CpGs with the Infinium Human MethylationEPIC Kit (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... combined with methylation data collected from the public TCGA LUAD study (Illumina Human Methylation 450k BeadChip) (Supplementary Table 1) ...
-
bioRxiv - Genomics 2024Quote: Human islet RNA-seq libraries were prepared from total RNA using the stranded TruSeq kit (Illumina). ERCC Mix 1 or Mix 2 spike-ins were randomly added to each sample (Thermo Fisher ...
-
bioRxiv - Bioengineering 2024Quote: The compressed paired-end human mRNA-seq data in fastq format over 80 gigabytes from Illumina PE150 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 µg of DNAse-treated RNA was treated with RiboZero Gold (Human/Mouse/Rat) kit (Illumina) to remove rRNAs ...
-
bioRxiv - Molecular Biology 2024Quote: ... we used the 318 curated files containing raw human blood expression data (FASTQ containing Illumina reads) of the Bgee project (see supplementary data of (Bastian et al ...
-
bioRxiv - Cell Biology 2020Quote: ... Whole genome sequencing was performed with 1 μg of the digested DNA using a HiSeq X Ten Sequencer (Illumina) at Macrogen (South Korea).
-
bioRxiv - Genomics 2019Quote: ... The libraries were sequenced with paired-end 150-bp reads on Hiseq X-ten or Novaseq 6000 platform (Illumina).
-
bioRxiv - Microbiology 2020Quote: The DNA library was prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina according to the manufacturer’s instructions and shotgun-sequenced using the Illumina MiSeq platform with a read length of 2 x 150bp (Illumina). In total ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries from four 10x channels were pooled together and sequenced on one lane of an Illumina HiSeq X (Illumina) by the Genomics Platform of the Broad Institute.
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Microbiology 2020Quote: ... One paired end sequencing run (2 x 301) was completed on an Illumina MiSeq instrument (Illumina, San Diego, CA) using v3 chemistry ...
-
bioRxiv - Microbiology 2020Quote: ... The genomic libraries were sequenced as 2 x 150 bp reads on Illumina Novaseq 6000 (Illumina, San Diego, CA) at UC San Francisco Sequencing Core to generate ~2.17 Gb of sequence ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing of a paired-end 2 × 150 bp mode on a HiSeq X system (Illumina, San Diego, CA, USA) was done by BGI Japan (Kobe ...
-
bioRxiv - Genetics 2022Quote: ... sequence reads were mapped to the mouse reference genome GRCm38/mm10 (iGenomes, Illumina; chromosomes 1-19, X, Y, M) using the Rsubread v1.28.1 package in R v3.4.4 ...
-
bioRxiv - Immunology 2020Quote: ... using the NucleoSpin RNA Kit from Macherey&Nagel according to the manufacturer’s instructions and sequenced on a MiSeq paired-end run (75 x 75, v3; Illumina). Samples were aligned to the mm10 transcript reference using TopHat2 ...
-
bioRxiv - Microbiology 2021Quote: ... normalized pools of all samples were sequenced on an Illumina MiSeq using the 2 x 150bp sequencing kit (Illumina). This Whole Genome Shotgun project has been deposited with the links to BioProject accession number PRJNA434045 in the NCBI BioProject database (http://www.ebi.ac.uk/ena/data/view/PRJEB21817 ...
-
bioRxiv - Microbiology 2021Quote: ... and sequenced on an Illumina HiSeq 2500 using TruSeq 2 x 100 base pair (bp) paired-end chemistry (Illumina) by UAGC.
-
bioRxiv - Microbiology 2021Quote: ... Paired-end Illumina sequencing (2 x 150 bp) was performed for each metagenomic library on Hiseq Xten instruments (Illumina).
-
bioRxiv - Genomics 2020Quote: ... These DNA libraries were clustered on a cBot Cluster Generation System using HiSeq X HD PE Cluster Kit (Illumina) and sequenced on an Illumina HiSeq X Ten platform at Novogene ...
-
bioRxiv - Microbiology 2022Quote: ... Paired-end sequencing (2×150 bp) and PCR-free whole genome sequencing was performed on a HiSeq X (Illumina) 54 ...
-
bioRxiv - Pathology 2023Quote: ... Barcoded libraries from each experimental sample were combined in equimolar concentrations of 1.5 pM prior to sequencing at 75bp x 1 (single-end) read metric on a NextSeq 550 (Illumina) system.
-
bioRxiv - Bioengineering 2023Quote: The libraries were paired-end sequenced on Illumina HiSeq X Ten sequencer for 150 cycles (Illumina, San Diego, USA) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... and 1.25µM indexing primers (Ad1_noMX primer and Ad2.x indexing primer 45 or IDT for Illumina dual index primers (Illumina, Nextera DNA UD Indexes Set A Ref 20025019) ...
-
bioRxiv - Genomics 2022Quote: ... and sequenced on a NovaSeq 6000 instrument (NovaSeq 6000 S2 Reagent Kit (Illumina, 20012861, PE 2 x 75 cycles)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... following the manufacturer’s protocols and sequenced using the 2 x 75 bases paired-end protocol on a NextSeq550 instrument (Illumina). For differential expression analysis ...
-
bioRxiv - Microbiology 2024Quote: ... A 2 x 300 bp paired-end sequencing was performed on an Illumina MiSeq platform (Illumina, Inc., Sandiego, CA).
-
bioRxiv - Molecular Biology 2023Quote: ... Pelleted nuclei were incubated in transposase reaction mix (1 X TD reaction buffer, 2.5 µl Tn5 transposase (Nextera, Illumina)) for 30 min at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... Sequencing was performed with 2 x 100 bp read length and 50 million clusters/probe on NovaSeq 6000 (Illumina). Normalization data was provided by CeGat ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Libraries were diluted to 2 nM in 10 μL 10 mM Tris-HCl (pH 8.5) and sequenced on a HiSeq2500 (Illumina) using a v2 Rapid SR50 cartridge (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: ... The chromatin was then tagmented by resuspending beads in 29 µl Tagmentation Buffer (10 mM Tris-HCl pH 8.0, 5 mM MgCl2, 10% dimethylformamide) and adding 1 µl of transposase (Illumina). Samples were incubated at 37 °C for 10 min and the reaction was terminated by adding 150 µl RIPA buffer ...
-
bioRxiv - Systems Biology 2023Quote: ... then loaded at 0.75nM and sequenced paired-end (Rd1:28 Rd2:10 Rd3:10 Rd4:50) on a Novaseq 6000 (Illumina).
-
bioRxiv - Genomics 2023Quote: ... We used 15 mins incubation on ice in the nuclei preparation step and the Tn5 reaction was performed in 50 μl of custom transposition buffer (10 mM Tris pH 8, 5 mM MgCl2 and 10% dimethylformamide) with 2.5 μl Tn5 transposase (Illumina, 20034197) at 37°C while mixing at 1000 rpm for 30 mins ...
-
bioRxiv - Molecular Biology 2021Quote: ... ribosomal RNAs were removed by a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, RZG1224). Then ...
-
bioRxiv - Genomics 2020Quote: ... microRNA expression profiling was performed using the human v2.0 microRNA Expression BeadChip (Illumina, Inc., San Diego, Calif) with 1146 microRNAs covering 97% of the miRBase 12.0 database according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... Total RNA was depleted from ribosomal RNA using Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat, Illumina) followed by cDNA library preparation as described below.
-
bioRxiv - Neuroscience 2022Quote: ... All samples were depleted of ribosomal RNA using the Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina) (replicates 1-3 and cycloheximide treated ...
-
bioRxiv - Genetics 2022Quote: ... Libraries were prepared using the Agilent SureSelect XT Human All Exon + UTR (v8) kit followed by Illumina NovaSeq 6000 150 cycle paired end sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... mRNA expression levels were extracted from microarray analyses performed on a Human HT-12-v4 BeadChip (Illumina) after labeling (Ambion ...
-
bioRxiv - Microbiology 2021Quote: ... Host ribosomal depletion was performed using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). Paired-end transcriptome sequencing was generated on the HiSeq2500 platform (Illumina).
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA samples were treated with a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) and used for RNA-Seq library preparation using an Illumina TruSeq Stranded Total RNA Library Prep Kit (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... Libraries for resequencing at high coverage (15 or 30x) were produced with an average insert size of 550 bp and sequenced on a HiSeq X instrument (Illumina). All libraries were sequenced at Edinburgh Genomics (Edinburgh Genomics ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end read sequencing (2×150 bp) was performed on the Illumina HiSeq X (Illumina, Inc., San Diego, CA, USA) using the Chromium library.
-
bioRxiv - Microbiology 2019Quote: ... and was sequenced from paired ends using 500 cycles with the HiSeq 2500 (2 x 250 bp) system (Illumina, USA).