Labshake search
Citations for Illumina :
451 - 500 of 796 citations for Peripheral Blood Mononuclear Cell since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... followed by library preparation according to the manufacturer’s recommendations (Single Cell 3’ V3 assay) and sequencing on a HiSeq4000 instrument (Illumina). Libraries were de-multiplexed ...
-
bioRxiv - Immunology 2022Quote: ... and sequenced single-end at 75 basepair read length with 60.000 reads per cell on a NextSeq500 platform (Illumina). Sequencing reads were mapped against the reference human genome (GRCh38 ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were generated with the Chromium Single Cell ATAC Library & Gel Bead Kit (1000111) and sequenced using the NextSeq 500/550 High Output Kit v2.5 (Illumina) on an Illumina NextSeq 550 platform ...
-
bioRxiv - Immunology 2022Quote: ... and sequenced single-end at 75 bp read length with 75.000 reads per cell on a NextSeq500 platform (Illumina). Sequencing reads were mapped against the reference human genome (GRCh38 ...
-
bioRxiv - Genomics 2022Quote: ... pooled and sequenced using 12 pM for the loading on rapid flow cells using the HiSeq 2500 system (Illumina). Sequencing mode was set as 20 dark cycles followed by 80 bases in single end reads (SR80).
-
bioRxiv - Neuroscience 2021Quote: ... nuclei were extracted from cells and treated with transposition mixture containing Nextera Tn5 Transposase for (Illumina, FC-121-1030). Transposed fragments were then purified using QIAGEN MinElute columns (QIAGEN ...
-
bioRxiv - Cancer Biology 2021Quote: ... and quantified by KAPA qPCR before sequencing on a single lane of a NovaSeq 6000 S4 flow cell (Illumina) to an average depth of 100,000 reads per cell.
-
bioRxiv - Molecular Biology 2022Quote: ... The full-length cDNA were synthesized using the Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 and sequenced by Illumina HiSeq X Ten platform by Gene Denovo Biotechnology Co ...
-
bioRxiv - Immunology 2022Quote: ... and Translational Core Facility at Cedars Sinai in the following manner: 50,000 cells per sample were lysed to collect nuclei and treated with Tn5 transposase (Illumina) for 30 minutes at 37°C with gentle agitation ...
-
bioRxiv - Physiology 2022Quote: ... cDNAs were prepared using the single cell 3’ Protocol as per manufacturer’s instructions and sequenced on a NovaSeq 6000 (Illumina) with 26 bases for read1 and 98×8 bases for read2.
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries from 384 to 768 cells with unique barcodes were combined and sequenced using a NextSeq 500 sequencer (Illumina).
-
bioRxiv - Physiology 2021Quote: ... Indexed library preps from each sample were then pooled and sequenced at a pool concentration of 1.3 pM on the NextSeq 500 using a NextSeq High Output 75 cycle flow cell (Illumina) with 75SE reads ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were prepared using Nextera XT reagents and sequenced on a MiSeq using a 2×250-mer paired-end v2 flow cell and manufacturer’s protocols (Illumina).
-
bioRxiv - Zoology 2020Quote: ... The library was loaded into a flow cell for cluster generation with the TruSeq Rapid SR Cluster Kit (Illumina) and was sequenced using the Illumina Hiseq 2500 System to obtain single-end 100-nucleotide sequences.
-
bioRxiv - Genomics 2021Quote: ... and sequencing was performed using eight SMRT Cells on a PacBio Sequel II instrument (Illumina, San Diego, California, USA). This yielded 787.76 Gb of sequence data ...
-
bioRxiv - Genomics 2021Quote: ... The final pool was sequenced on one lane of a NovaSeq 6000 S4 150 bp PE flow cell (Illumina).
-
bioRxiv - Neuroscience 2021Quote: ... Genome integrity and cell identity tracking was assessed using the Human CytoSNP-12v2.1 beadchip array or OmniExpress24 array (Illumina) on genomic DNA generated using the All-Prep kit (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... multi-cell sibling and bulk parental or grandparental DNA were genotyped on BovineHD BeadChips (Illumina, San Diego, California, US). Subsequently ...
-
bioRxiv - Pathology 2021Quote: ... Single cell transcriptome libraries of liver cells were prepared with Chromium Single Cell 3’ NextGEM Reagent Kit v3.1 (10X Genomics) to performed sequencing on NextSeq 550 (Illumina) and demultiplexing pipeline with CellRanger v5.0.0 (10x Genomics) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mini kit for DNA from cells and tissue (Macherey Nagel, Ref: 740952.50) and sequenced on a NovaSeq 6000 (Illumina) with a 100X depth.
-
bioRxiv - Genomics 2020Quote: ... The supernatant was discarded and cells were resuspended directly in Dig-transposition buffer (25 μl 2x TD Buffer [Illumina] ...
-
bioRxiv - Genetics 2021Quote: ... which was then loaded on a high-output flow cell (NextSeq 500/550 High Output Kit v2.1, 300 cycles; Illumina) for sequencing on an Illumina NextSeq 550 sequencer ...
-
bioRxiv - Immunology 2020Quote: ... libraries were prepared (384 cells per library) using the Illumina Nextera XT kit (Illumina Inc, San Diego, CA, USA). Index v2 sets A ...
-
bioRxiv - Microbiology 2021Quote: ... Sample libraries were pooled and diluted to 200pm and 100µl of this diluted sample was loaded onto a flow cell for NGS using an iSeq 100 (Illumina). Sequences were assembled using reference mapping with paired ends in Geneious R10 (Biomatters ...
-
bioRxiv - Developmental Biology 2020Quote: ... Biological triplicates or duplicates (Table S3) of RNA from each cell line were sequenced on a HiSeq 2500 (Illumina) using 75bp paired-end sequencing.
-
bioRxiv - Genomics 2021Quote: ... High quality samples were then sequenced to a minimum of 50,000 reads per cell on a NextSeq 500 sequencer (Illumina) using a 75-cycle High Output kit using a custom read1 primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC).
-
bioRxiv - Genetics 2020Quote: ... and sequencing on a MiSeq with a 600-cycle flow cell (MiSeq Sequencing Kit v3, 600 bp, Illumina, Inc.) were performed according to the manufacturer’s protocols ...
-
bioRxiv - Immunology 2021Quote: ... Single cell libraries were multiplexed into a single lane and were sequenced at a target read depth of 100,000 reads/cell using a NovaSeq sequencer (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... Cell populations were then processed for next-generation sequencing as previously described18 and sequenced on a HiSeq-4000 (Illumina). Reads were analyzed by using the MAGeCK pipeline as previously described19 ...
-
bioRxiv - Neuroscience 2022Quote: ... on a single flow cell using the 300-cycle S4 Reagent kit (2×150 bp paired-end reads; Illumina).
-
bioRxiv - Developmental Biology 2022Quote: Single cell libraries were sequenced using Illumina NextSeq 500/550 and NovaSeq 6000 sequencing systems (Illumina, San Diego, CA). The generated binary base call (BCL ...
-
bioRxiv - Cell Biology 2022Quote: ... Bulk sequencing was run on a NovaSeq 6000 instrument using one lane of an S4 v1.5 flow cell (Illumina), 2B paired-end reads ...
-
bioRxiv - Cell Biology 2022Quote: ... Single cells were dispatched into a 96-plate well containing 5μL 1x lysis buffer containing Murine RNase inhibitor (NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina).
-
bioRxiv - Genomics 2022Quote: ... The library was then loaded onto an iSeq i1 V2 reagent cartridge with a 300-cycle flow cell (Illumina) with 5% Phi X and run for 290 cycles in a single direction on an Illumina iSeq 100 (see Supplementary Table 2 for number of sequencing reads).
-
bioRxiv - Neuroscience 2022Quote: ... Next-generation sequencing (VIB Nucleomics Core) of the single-cell libraries was carried out on a NovaSeq 6000 (Illumina) platform with the following read configuration ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of 20 libraries containing 95 biological replicates were sequenced targeting 90% mRNA and 10% hashtag oligo library (50,000 reads/cell) on a HiSeq4000 or NovaSeq6000 (Illumina) platform with the recommended read lengths by 10X Genomics workflow.
-
bioRxiv - Microbiology 2022Quote: ... Samples were equimolarly pooled and sequenced on NextSeq™ 500 High Output Kit v2.5 (75 cycles) flow cell (Illumina) with 1 x 75 bp read length.
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared according to the manufacturer’s protocol using 10X Single-Cell 3’ v3.1 chemistry (10X Genomics, PN-1000128) and sequenced on the NovaSeq platform (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... The capture libraries were sequenced in the iSeq 100 using the i1 Flow Cell and Reagent Cartridge v2 (Illumina) for 300 cycles ...
-
bioRxiv - Cancer Biology 2023Quote: ... Single-cell libraries were generated using 10X Genomics Chromium Single-cell 3’ Library RNA-Seq Assays protocols targeting 8,000 cells from each fraction were sequenced on the NovaSeq sequencer (Illumina). The scRNA-seq data were analyzed with the Partek Flow software (Partek Inc) ...
-
bioRxiv - Cell Biology 2023Quote: ... The captured fragments were pair-end sequenced by 101 bp reading using NovaSeq 6000 with S4 flow cell (Illumina). Sequenced reads were aligned to reference human genome (GRCh37/hg19 ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were prepared according to the 10x Genomics Single Cell ATAC v1.1 protocol (CG000209) and pooled for sequencing on a NextSeq500 instrument (Illumina) (Read1 ...
-
bioRxiv - Cell Biology 2023Quote: ... The snRNA-seq library were constructed with 10x Genomic protocol (Chromium Single Cell 3’ Reagent Kits v3.1User Guide) and sequenced by Illumina NovaSeq.
-
bioRxiv - Genomics 2023Quote: ... The cDNAs from each cell were pooled and a library was generated and sequenced with a NovaSeq 6000 (Illumina). We sequenced two biological replicates to a sequencing depth of ∼1 billion reads each ...
-
bioRxiv - Synthetic Biology 2023Quote: ... RNA and plasmid DNA libraries were sequenced using a 50 cycle SP flow cell on a NovaSeq 6000 (Illumina) using custom sequencing primers (Table S4).
-
THE OLFACTORY RECEPTOR Olfr78 REGULATES DIFFERENTIATION OF ENTEROCHROMAFFIN CELLS IN THE MOUSE COLONbioRxiv - Cell Biology 2023Quote: ... before processing through the Chromium Next GEM Single Cell 3’ Reagent Kits V3.1 (10X Genomics) and sequenced on a Novaseq 6000 (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... cDNAs were prepared using the single cell 30 Protocol as per manufacturer’s instructions and sequenced on a NovaSeq instrument (Illumina) with 26 bases for read 1 and 98 bases for read 2.
-
bioRxiv - Neuroscience 2024Quote: ... Samples were sequenced to a target read depth of ∼160 million paired end reads per library (19,291 reads/cell on average) using Illumina NovaSeq (Illumina). Library preparation and sequencing were performed at the KU Leuven Genomics Core (https://www.genomicscore.be/).
-
bioRxiv - Cancer Biology 2023Quote: ... Gel-in-beads and libraries were generated using Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 (10x Genomics) and sequenced using NovaSeq (Illumina). Cell Ranger 7.0.1 ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were loaded onto an Illumina MiSeq using a 2×300 v3 flow cell (Illumina, San Diego, CA) and sequenced to an average depth of 87,099 reads per sample ...