Labshake search
Citations for Illumina :
251 - 300 of 9545 citations for Mouse T cell receptor alpha chain C region TCRA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... All Hi-C libraries were sequenced by Illumina sequencing ...
-
bioRxiv - Genomics 2023Quote: ... and Hi-C (Illumina NovaSeq 6000, 2×150bp) for chromosome-level scaffolding (Fig ...
-
bioRxiv - Microbiology 2024Quote: The Illumina TruSeq Stranded Total RNA Sample Prep Kit with Ribo-Zero Human/Mouse/Rat protocol (Illumina, Inc. San Diego, CA, USA) was used for the following steps ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human/Mouse/Rat (Illumina, discontinued), and fragmented by incubating with PNK buffer (NEB ...
-
bioRxiv - Genomics 2019Quote: ... mouse and rat (Illumina, USA). Sequencing has been done with 2×250 bp paired-end on a HiSeq 2500 (Illumina ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1 μl of each Nextera XT Index Kit v2 set B or set C barcoding primer (Illumina, Cat# FC-131-2002 or FC-131-2003). These reactions were then incubated at 95°C for 15 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... libraries were constructed with Single Cell 3ʹ Reagent Kits v2 before sequencing by Illumina Novaseq.
-
bioRxiv - Cancer Biology 2022Quote: ... 50.000 MDA-MB-231 cells infected with shControl (C) or shLOXL2 (KD) were collected and treated with transposase Tn5 (Nextera Tn5 Transposase, Illumina Cat #FC-121-1030). DNA was purified using AMPure XP beads to remove big fragments (0.5x beads ...
-
bioRxiv - Systems Biology 2019Quote: ... Set C: indexes 25–36 (Illumina, RS-200-0036), Set D ...
-
bioRxiv - Pathology 2024Quote: ... aphidicola (C, D) based on SNPs identified from Illumina sequencing ...
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...
-
bioRxiv - Genomics 2021Quote: ... Bulk cell line libraries were sequenced on the NextSeq using the Mid-Output kit (Illumina). Cord blood ...
-
bioRxiv - Neuroscience 2023Quote: ... and converted to cDNA (NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina). cDNA from each sample was amplified and barcoded in a mild stringency PCR (20 cycles of 30 seconds at 98°C ...
-
bioRxiv - Immunology 2023Quote: ... For Infinium Mouse Methylation BeadChip (Illumina) arrays ...
-
bioRxiv - Systems Biology 2024Quote: ... in two growth media conditions (CMAF and Basal)—were profiled by Illumina BeadArrays (mouse WG-6 v2, Illumina). Poor quality profiles were removed ...
-
bioRxiv - Systems Biology 2024Quote: ... Illumina BeadArrays (mouse WG-6, Illumina) were used to profile the transcriptome of 33 independent EpiSC samples ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μg of bacterial RNA was treated for ribosomal RNA (rRNA) removal by using a Ribo-Zero rRNA Removal Kit (Mouse and Bacteria) (Illumina Inc., San Diego, CA). Directional RNA-seq libraries were created using TruSeq RNA Sample Prep Kit v2 (Illumina Inc.) ...
-
bioRxiv - Immunology 2023Quote: ... alpha/beta libraries were prepared on 100 ng of RNA from each sample using the SMARTer Mouse TCR α/β Profiling Kit from Takarabio® and sequenced using the MiSeq V2 2×150bp (Illumina®) and HiSeq2500 V2 2×150bp (Illumina® ...
-
bioRxiv - Developmental Biology 2024Quote: ... Approximately 1 ng of cDNA per cell was transformed into a single-cell library using the Nextera XT DNA Library prep kit (Illumina FC-131-1096) and following the manufacturer’s instructions with slight modifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Molecular Biology 2019Quote: ... or conventional short read RNA-seq of fragmented cDNAs at 20 million (T) or 100 million (N) read depth (Illumina). Full length RNA-seq data were processed using the ToFU platform ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA integrity was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA 95051 USA. mRNA was isolated using poly T beads, whereafter Illumina libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit ...
-
bioRxiv - Genetics 2024Quote: ... we aligned the corresponding short reads to the human reference GRCh38 using bwa mem23 (v 0.7.17-r1188; -t 48 -R “@RG\tID:1\tLB:lib1\tPL:ILLUMINA\tSM:
\tPU:unit1”). Next ... -
bioRxiv - Microbiology 2024Quote: ... Raw genomic reads obtained by Illumina HiSeq 2500 and NovaSeq 6000 (for D. grisea, E. coxiae, Galdieria sp. ACUF 613, M. erythrocladioides, P. aerugineum, and T. oligopyrenoides) and by Illumina HiSeq 2500 and NovaSeq 6000 plus Oxford Nanopore MinION Mk 1B (for R ...
-
bioRxiv - Genomics 2022Quote: ... The Hi-C library was amplified using PE primers (Illumina) with 10 PCR amplification cycles ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... equimolar amounts of the libraries underwent a c-Bot (Illumina) bridge PCR followed by single end sequencing for 77 cycles on an Illumina Hiseq2500 ...
-
bioRxiv - Genomics 2023Quote: ... The Hi-C library was amplified using PE primers (Illumina) with 10 PCR amplification cycles ...
-
bioRxiv - Genomics 2023Quote: ... Illumina Nextera DNA Unique Dual Indexes Set C (Illumina, 20027215) were added and amplified (12 cycles ...
-
bioRxiv - Genomics 2020Quote: ... Lysed cells were then transposed using the Nextera DNA library prep kit (Illumina #FC-121-1030) for 30 min at 37C ...
-
bioRxiv - Microbiology 2021Quote: Clusters were generated on a flow cell within a cBot using the Cluster Generation Kit (Illumina). Libraries were sequenced as 50 bp-reads on a HiSeq 2500 using the sequence by synthesis technique (Illumina) ...
-
bioRxiv - Systems Biology 2022Quote: ... high-throughput RNA sequencing was performed with NovaSeq 6000 S4 reagent kit and flow cell (Illumina). Sequence read files were quality assessed and trimmed with FastQC v0.11.9 [25] and Trimmomatic v0.39 [26] ...
-
bioRxiv - Molecular Biology 2022Quote: The LSK cell samples obtained by sorting were processed with the DNA Library Prep Kit (Illumina). The tagged DNA was purified with the DNA Clean ConcentratorTM5 Kit (Zymo Research) ...
-
bioRxiv - Microbiology 2021Quote: ... before loading on the flow cell of the 500 cycle MiSeq Reagent Kit v2 (Illumina, USA) and pair-end sequencing (2 × 250 bp) ...
-
bioRxiv - Microbiology 2022Quote: ... 100,000 cells were used to for transposition reaction (Illumina Tagment DNA TDE1 Enzyme and Buffer Kit). Tagmented DNA was purified with MinElute purification kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Equimolarly pooled libraries were sequenced on a MiSeq Reagent Kit v2 (300 cycles) flow cell (Illumina) with 2 x 150 bp read length ...
-
bioRxiv - Microbiology 2023Quote: ... the flow cell was loaded onto HiSeq 2500 for sequencing using HiSeq SBS kit v4 (Illumina). DNA was sequenced from both ends (paired-end ...
-
bioRxiv - Microbiology 2023Quote: ... was applied with S2 flow cells and the 2 x 150 bp paired-end kit (Illumina) according to company protocols ...
-
bioRxiv - Developmental Biology 2024Quote: ... Single-cell RNA-seq libraries were prepared using a Nextera XT DNA Library Preparation Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: Directional libraries were constructed using NEBNext Single Cell/Low Input RNA Library Prep Kits from Illumina following manufacturer instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... the flow cell was loaded onto HiSeq 2500 for sequencing using HiSeq SBS kit v4 (Illumina). DNA was sequenced from both ends (paired-end ...
-
bioRxiv - Genetics 2023Quote: ... The mm10 mouse genome manifest from Illumina was used as reference ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared following 10X Genomics protocols (Chromium Single Cell 3’ Reagent Kits v2 Chemistry) and sequenced on NovaSeq 6000 (Illumina S2 flow cell, paired-end). FASTQ files were processed using cellranger (https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger ...
-
bioRxiv - Genomics 2019Quote: ... Hi-C libraries were prepared for sequencing on HiSeq 4000 (Illumina). After sequencing ...
-
bioRxiv - Microbiology 2020Quote: Clusters were generated on a flow cell with within a cBot using the Cluster Generation Kit (Illumina). Libraries were sequenced as 50 bp-reads on a HiSeq 2500 using the sequence by synthesis technique (Illumina) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries from a total of 91 single cells were prepared using a Nextera XT index kit (Illumina) and quantified both using Library Quant Kit (Illumina - LC480 ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA libraries for A/E9a;NRASG12D tumor cells were generated using TruSeq RNA Library Prep kit (Illumina) and sequenced in a HiSeq2000 sequencer SE50bp (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then loaded on the flow cell from Novaseq S4 300cycle kit (Illumina, San Diego, CA, USA), and the XP-4lane kit (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... The prepared flow cell and SBS cartridge from Novaseq S4 300cycle kit (Illumina, San Diego, CA, USA) were inserted into the Novaseq 6000 system and sequenced using 151-10-10-151 running parameters ...
-
bioRxiv - Immunology 2022Quote: ... sample tags: 600 reads per cell on Illumina NovaSeq using S1 and S2 100 cycle kits (Illumina) (67×8×50 bp) ...
-
bioRxiv - Cancer Biology 2020Quote: ... About 50,000 cells of each condition were treated with transposase Tn5 (Nextera DNA Library Preparation Kit, Illumina), and DNA was purified using MinElute PCR Purification Kit (Qiagen ...