Labshake search
Citations for Illumina :
251 - 300 of 9614 citations for Human Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: Samples were prepared using a Chromium Single Cell 3’ Reagent Kit (10x Genomics) and run on a NovaSeq S4-200 cell (Illumina).
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Genomics 2019Quote: ... the nuclei pellets were resuspended in transposase Master Mix (1.25 μl 10x TD buffer, 5 μl H2O and 6.5 μl of Tn5: Illumina Nextera Kit; FC-121-1031) and incubated for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... indexing and amplification of the transposed DNA samples was performed by combining 10 µL of transposed DNA with the following: 5 µL of the Nextera i5 and i7 indexed amplification primers (Nextera Index Kit, Illumina, FC-121-1011), 25 μl of the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 TLX1/TLX3 and 5 HOXA) was performed using the TruSeq Stranded Total RNA (w/RiboZero Gold) sample prep kit (Illumina, RS-122-2301), involving depletion of ribosomal (rRNA ...
-
bioRxiv - Genomics 2021Quote: ... RNA-seq libraries were prepared from 500 ng total RNA using the TruSeq stranded mRNA library preparation kit (Illumina Inc, Cat# 20020594/5) including polyA selection ...
-
bioRxiv - Immunology 2020Quote: ... PCR amplification and index incorporation were performed in a 50 μl reaction containing 5 μl of forward and reverse index primers (Illumina Nextera Index Kit), 15 μl NPM ...
-
bioRxiv - Genomics 2020Quote: ... Individual cells were sequenced to a mean depth of ~1.5 million 38 bp paired-end reads on an Illumina NextSeq 500 instrument with 75 cycle high output kits (Illumina TG-160-2005).
-
bioRxiv - Microbiology 2024Quote: Total RNA of 5 μg was used to construct strand-specific RNA-sequencing libraries using the TruSeq RNA sample preparation Kit from Illumina (San Diego, CA). Briefly ...
-
bioRxiv - Developmental Biology 2022Quote: ... libraries were constructed with Single Cell 3ʹ Reagent Kits v2 before sequencing by Illumina Novaseq.
-
bioRxiv - Cancer Biology 2021Quote: ... RNAseq-based gene expression and methylation array (Illumina human methylation450K array) data were downloaded from the ICGC data Portal (https://dcc.icgc.org/ ...
-
bioRxiv - Molecular Biology 2020Quote: ... Methylation was analysed using the Infinium Human Methylation EPIC array (Illumina) using standard operating procedures at the UCL Genomics facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... Probe locations on the human genome (hg19 version) defined by Illumina was used for the analysis ...
-
bioRxiv - Cancer Biology 2020Quote: Human RNA sequencing data and DNA sequencing data (Illumina HiSeq RNASeqV2) from the Colorectal Adenocarcinoma dataset from The Cancer Genome Atlas (Nature 2012 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (2022) sequenced 2,504 human genomes to 30x coverage (Illumina NovaSeq 6000). They mapped these data to the human genome assembly GRCh38 and called genotypes using GATK HaplotypeCaller ...
-
bioRxiv - Cancer Biology 2023Quote: Human RNA sequencing data and DNA sequencing data (Illumina HiSeq RNASeqV2) from the Colorectal Adenocarcinoma dataset from the TCGA Nature 2012 and TCGA PanCancer Atlas from The Cancer Genome Atlas were downloaded from cBioPortal for Cancer Genomics (https://www.cbioportal.org/).57–59 Data was log2 transformed and analyzed using the DESeq2 package in R (v3.0).60
-
bioRxiv - Cancer Biology 2019Quote: ... To this end shotgun libraries were generated from 5-10ng of plasma DNA using the TruSeq DNA Nano Sample Preparation Kit (Illumina, San Diego, CA, USA) as previously described[35] ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added four mate pair libraries (3 kb, 5 kb, 7 kb, 8 kb) prepared using a Nextera Mate Pair Library Prep kit (Illumina, San Diego, CA, USA). Each library was sequenced on an Illumina HiSeq 2500 sequencer by Novogene (Sacramento ...
-
bioRxiv - Genomics 2019Quote: ... A mate pair library with an insert size of 5 kb was created with the Nextera Mate Pair Sample Prep Kit (Illumina, San Diego, CA, USA). The paired-end and mate pair libraries were sequenced on an Illumina MiSeq machine ...
-
bioRxiv - Genomics 2020Quote: Small RNA libraries were prepared starting from 5 µL DNase treated and spike-in supplemented RNA eluate using a TruSeq Small RNA Library Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol with two minor modifications(1) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...
-
bioRxiv - Genomics 2021Quote: ... Bulk cell line libraries were sequenced on the NextSeq using the Mid-Output kit (Illumina). Cord blood ...
-
bioRxiv - Neuroscience 2023Quote: ... and converted to cDNA (NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina). cDNA from each sample was amplified and barcoded in a mild stringency PCR (20 cycles of 30 seconds at 98°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Approximately 5 ug of total RNAs were used to construct cDNA libraries (NEBNext Ultra Directional RNA Library Prep Kit for Illumina, Illumina, San Diego, CA, USA). Transcriptome sequencing was performed using the Illumina Hi-Seq 2000 platform ...
-
bioRxiv - Neuroscience 2022Quote: Total RNAs from cultured mouse WT and CD38 KO astrocytes at 5 DIV were used for RNA library preparation using TruSeq Stranded mRNA Sample Preparation Kit (Illumina, Inc., San Diego, CA, USA), with polyA selection for ribosomal RNA depletion.
-
bioRxiv - Developmental Biology 2024Quote: ... Approximately 1 ng of cDNA per cell was transformed into a single-cell library using the Nextera XT DNA Library prep kit (Illumina FC-131-1096) and following the manufacturer’s instructions with slight modifications ...
-
bioRxiv - Cancer Biology 2021Quote: ... these analyses were performed on a Human HT-12-v4 BeadChip (Illumina) after labeling (Ambion ...
-
bioRxiv - Neuroscience 2020Quote: ... The Illumina Human CytoSNP-12v2.1 BeadChip array and KaryoStudio analysis software (Illumina) were used to assess genome integrity (Supplementary Table 1).
-
bioRxiv - Genomics 2022Quote: ... we benchmarked 23 different human genotyping arrays including 14 arrays from Illumina and 9 arrays from Affymetrix ...
-
bioRxiv - Genomics 2020Quote: ... Illumina TruSeq Stranded Total RNA Ribo-Zero Human/Mouse/Rat Gold (Illumina) was used to construct ribosomal RNA depleted sequencing libraries ...
-
bioRxiv - Molecular Biology 2019Quote: ... Trimmed reads were mapped to the human genome (hg38 downloaded from Illumina iGenomes on August 8th ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... DNA methylation was quantified using Infinium Human Methylation 27 BeadChip (Illumina, CA) at the Northwestern University Core facility.
-
bioRxiv - Genetics 2021Quote: ... whereas the Illumina Human HT-12 v4 beadchip (Illumina, San Diego, CA) is a genome-wide array targeting about 31,000 genes (with on average 2 probes per gene ...
-
bioRxiv - Genomics 2021Quote: ... DNA methylation levels were measured using Infinium Human Methylation 450 arrays (Illumina) according to the manufacturer’s protocol.
-
bioRxiv - Genetics 2024Quote: ... or in the Human Imprintome array BeadChip (Illumina, Inc., San Diego, CA), amplified ...
-
bioRxiv - Cell Biology 2023Quote: ... RNase H or the Ribo-Zero method (human, mouse, plants) (Illumina, USA) was used to remove rRNA ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was analyzed using Infinium Human Methylation 450K BeadChip system (Illumina), as described [91] ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Neuroscience 2020Quote: ... 50bp RNA-seq of IP fractions and total homogenate from 5 replicates per cell type (20 samples total) was performed on a single lane of a HiSeq 3000 (Illumina, San Diego, California), yielding ∼350M reads ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Molecular Biology 2019Quote: ... or conventional short read RNA-seq of fragmented cDNAs at 20 million (T) or 100 million (N) read depth (Illumina). Full length RNA-seq data were processed using the ToFU platform ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA integrity was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA 95051 USA. mRNA was isolated using poly T beads, whereafter Illumina libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit ...
-
bioRxiv - Genetics 2024Quote: ... we aligned the corresponding short reads to the human reference GRCh38 using bwa mem23 (v 0.7.17-r1188; -t 48 -R “@RG\tID:1\tLB:lib1\tPL:ILLUMINA\tSM:
\tPU:unit1”). Next ... -
bioRxiv - Microbiology 2024Quote: ... Raw genomic reads obtained by Illumina HiSeq 2500 and NovaSeq 6000 (for D. grisea, E. coxiae, Galdieria sp. ACUF 613, M. erythrocladioides, P. aerugineum, and T. oligopyrenoides) and by Illumina HiSeq 2500 and NovaSeq 6000 plus Oxford Nanopore MinION Mk 1B (for R ...
-
bioRxiv - Genomics 2020Quote: ... Lysed cells were then transposed using the Nextera DNA library prep kit (Illumina #FC-121-1030) for 30 min at 37C ...
-
bioRxiv - Microbiology 2021Quote: Clusters were generated on a flow cell within a cBot using the Cluster Generation Kit (Illumina). Libraries were sequenced as 50 bp-reads on a HiSeq 2500 using the sequence by synthesis technique (Illumina) ...