Labshake search
Citations for Illumina :
201 - 250 of 9614 citations for Human Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Microbiology 2023Quote: ... 3-5 µg of each sample was treated with Ribozero® rRNA Removal Kit according to the manufacturer’s instructions (Illumina, USA ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Genomics 2022Quote: Small RNA libraries were prepared starting from 5 µL RNA eluate using the TruSeq Small RNA Library Prep Kit (Illumina, RS-200-0012 ...
-
bioRxiv - Cancer Biology 2023Quote: RNA-seq libraries were prepared with 0,5-1 µg of total high quality RNA collected from samples and the Illumina Stranded Total RNA Prep kit (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Systems Biology 2023Quote: ... approximately 5×104 cells were lysed and transposed reactions were carried out using Tn5 Transposase (Illumina, #FC121-1030) at 37 °C for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Genomics 2022Quote: ... Libraries were generated with the Chromium Single Cell ATAC Library & Gel Bead Kit (1000111) and sequenced using the NextSeq 500/550 High Output Kit v2.5 (Illumina) on an Illumina NextSeq 550 platform ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Genomics 2020Quote: ... Human libraries were sequenced on a NovaSeq 6000 (Illumina) and mouse libraries on a NextSeq 500 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA expression log intensity levels (Illumina Human v3 microarray) were used as the expression levels of the genes ...
-
bioRxiv - Immunology 2021Quote: ... 1.5 ng cDNA was tagmented using 0.5 μl TruePrep Tagment Enzyme V50 and 1x TruePrep Tagment Buffer L (TruePrep DNA Library Prep Kit V2 for Illumina, Vazyme), followed by an incubation step at 55 °C for 10 min ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Purified PCR products were given unique dual indexes at the 5’ end using the Nextera XT Index Kit v2 index primers (Illumina, USA). To attach the index primers ...
-
bioRxiv - Immunology 2020Quote: ... Supernatant was discarded and nuclei were re-suspended in 50 μl reaction buffer containing 5.0 μl Tn5 transposase and 10 μl of 5 × TTBL buffer (TruePrepTM DNA Library Prep Kit V2 for Illumina, Vazyme Biotech). The reaction was incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... Samples were concentrated using a centrifugal evaporator Speed Vac® to a final volume of 5 μl and we started the TruSeq Small RNA Sample Preparation Kit (Illumina) protocol according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: Sequencing libraries were prepared from 100 ng DNA using the TruSeq Nano DNA sample preparation kit (cat# 20015964/5, Illumina Inc.) targeting an insert size of 350bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Extracted nuclei was processed for TN-5 mediated tagmentation using the Illumina Tagment DNA Enzyme and buffer kit (Nextera Illumina # 20034210) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Ribosomal RNAs were depleted from 5 μg of total RNA of the sample by Ribo-Zero rRNA Removal Kit (Seed, Root) (Illumina®). After rRNA depletion ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nextera libraries (5 replicates) were constructed from 0.8 ng of pre-amplified cleaned up cDNA using Nextera XT Kit (Illumina, Eindhoven, Netherlands). Index PCR was carried out using the custom P5 primer (P5NEXTPT5 ...
-
bioRxiv - Neuroscience 2023Quote: ... and a duplicate unrelated control sample was diluted to 5 ng/µl in low TE provided in AmpliSeq Library PLUS (384 Reactions) kit (Illumina, 20019103). AmpliSeq was carried out following the manufacturer’s protocol (document 1000000036408v07) ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared from 700 ng total RNA using the TruSeq stranded mRNA library preparation kit (Cat# 20020594/5, Illumina Inc.) including polyA selection ...
-
bioRxiv - Microbiology 2023Quote: ... Amplicon libraries were mixed with 5% PhiX and sequenced with MiSeq reagent kits v2 500 cycles (Illumina, San Diego, California, USA). A blank extraction kit control ...
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Cancer Biology 2022Quote: ... ScRNA-seq libraries were prepared using the Next GEM Chromium single cell 3′ reagent kits V3.1 with feature barcode technology for cell surface protein (10x genomics) and sequenced using NextSeq 500 high output kits and Novaseq S4 PE100 kits (Illumina). scRNA-Seq data after standard quality control was aligned to the reference genome (mm10 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was prepared using the manufacturers protocol (Chromium Single Cell 3’ reagent kits kit v3, 10x Genomics) and sequenced on a Novaseq 6000 instrument (Illumina). After sample processing and quality control analysis ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The abundance of the guide RNAs in the T = 0 and T10 replicates was determined by Illumina Next Generation Sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... using an Illumina HiSeq Flow Cell v4 and TruSeq SBS Kit v4 (Illumina). Raw sequencing read data was processed using RTA version 1.18.61 and CASAVA 1.8.4 to generate FASTQ-files ...
-
bioRxiv - Developmental Biology 2022Quote: ... ATAC-seq libraries were generated from the cells using the Nextera Kit (Illumina), as previously reported (Buenrostro et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the NovaSeq 6000 SBS v1 Kit and an S4 flow cell (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... Hamilton using a NovaSeq SP flow cell with the 500 cycle kit (Illumina) and 5% PhiX spike in ...
-
bioRxiv - Cancer Biology 2021Quote: The Illumina Infinium Human Methylation 450k BeadChip (Illumina 450K array) prostate adenocarcinoma dataset was downloaded from the TCGA consortium database ...
-
bioRxiv - Genetics 2019Quote: ... and genotyped on the Infinium Human CoreExome-24 BeadChip (Illumina). Variants missing >5% of total genotypes and variants that deviated from Hardy-Weinberg equilibrium were removed ...
-
bioRxiv - Cancer Biology 2019Quote: ... and TruSeq Stranded Total RNA Human/Mouse/Rat (Illumina, 20020596) with 100 ng of input and 13 PCR cycles ...
-
bioRxiv - Molecular Biology 2022Quote: The Illumina Infinium® human 450k (Illumina, WG-314-10031) and EPIC methylation (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... IM and YA using the Sentrix Human CNV370 BeadChip (Illumina) and analysed using GenomeStudio software.
-
bioRxiv - Cell Biology 2020Quote: ... Purified cells were lysed in ATAC lysis buffer for 5 min to get nuclei and then transposed with Tn5 transposase (Illumina) for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were pooled and sequenced single-end for 75 cycles on one high-output flow cell of an Illumina NextSeq with 5% PhiX control (Illumina) added to provide sequence diversity ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Cancer Biology 2019Quote: ... Single cell library preparation was performed using a Chromium Single Cell 3’ Reagent Kit v3 (10X Genomics) and sequenced by Illumina HiSeq ...
-
bioRxiv - Cancer Biology 2021Quote: ... for single-cell RNA sequencing (with the 10X Genomics single-cell gene expression kit, a 400M read flow cell & single-end read using HiSeq from Illumina). 2,453 cells were sequenced with an average of 64,404 reads (and 3,457 genes ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... RNA-sequencing libraries were then prepared from RNA isolated from the bulk mutant AML bone marrow cells and the normal CD34+ bone marrow cells using TruSeq Stranded Total RNA kit (Illumina) described above ...