Labshake search
Citations for Illumina :
301 - 350 of 686 citations for Family With Sequence Similarity 46 Member B FAM46B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: Sequence-ready libraries were prepared using the Nextera (Illumina Corp., San Diego, CA) and HyperPlus DNA kits (Roche Diagnostics ...
-
bioRxiv - Genomics 2023Quote: ... The nucleotide sequences of the resultant libraries were determined using HiSeq 1000 (Illumina) in paired-end ...
-
bioRxiv - Genetics 2023Quote: After demultiplexing the barcoded sequences using the CASAVA pipeline v.1.8 (Illumina, Inc.), the GBS data were processed using GBS2popgen.sh (available on GitHub at ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sequence reads were demultiplexed and basecalled using “bcl2fastq” (Illumina Inc., San Diego, CA). FASTQ files were aligned to a custom genome (based on the amplicon sequences ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... (b) after index annealing with the Illumina indexing primer set (Illumina, #20020492), 12 PCR cycles were used for cDNA amplification ...
-
bioRxiv - Plant Biology 2023Quote: ... and together with Illumina TruSeq DNA sgl Index Set A/B (Illumina) to perform adapter ligation ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Nextera XT Index Kit v2 Set B (FC-131-2002, Illumina). 1.5 µl Nextera PCR Master Mix and 0.5 µl of a unique combination of primers were added to each well using the I.DOT and tagmented cDNA was amplified in a C1000 Thermal Cycler (72 °C for 3 min ...
-
bioRxiv - Microbiology 2024Quote: ... with the Nextera XT v2 Index Kit B (Illumina FC-131-2002) and then subsequently sequenced on an Illumina MiSeq instrument using a MiSeq Reagent kit v3 600 cycle (Illumina MS-102-3033 ...
-
bioRxiv - Plant Biology 2019Quote: ... Pair-end 100bp sequence reads were generated using the Illumina Genome Analyzer II (Illumina) and Illumina HiSeq 2000 (Illumina ...
-
bioRxiv - Cell Biology 2019Quote: ... Ribosomal rRNA sequences were removed using a Ribo-Zero Gold rRNA removal kit (Illumina), the rRNA-free eluate was again column-purified (RNA Clean & Concentrator-5 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... raw sequence data were filtered for contaminants (E. coli, PhiX, Illumina adaptors or primers) and low quality reads using bowtie2_db (Langmead & Salzberg ...
-
bioRxiv - Microbiology 2022Quote: ... sequence data was demultiplexed and Fastq files generated using Bcl2Fastq conversion software from Illumina.
-
bioRxiv - Immunology 2022Quote: ... Consensus sequences were obtained by using the DRAGEN COVID lineage software (Illumina, ver. 3.5.6). Variant calling and annotation were performed using the Nextclade website (https://clades.nextstrain.org).
-
bioRxiv - Genetics 2020Quote: ... reverse transcription was performed with Reverse Transcription Primer (RTP) (Illumina sequence, ordered via IDT) and SuperScript IV Reverse Transcriptase (ThermoFisher #18090050) ...
-
bioRxiv - Plant Biology 2019Quote: ... the sequence libraries were prepared using a TruSeq ChIP Sample Preparation Kit v2 (Illumina), and sequenced using an Illumina NextSeq 500 system with a 75-nt single-end sequencing protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... 80 to 100 million single end sequence reads were obtained on a HiSeq4000 (Illumina) with 151 bp read length.
-
bioRxiv - Microbiology 2021Quote: Following demultiplexing of paired-end sequence reads using MiSeq Reporter software version 2.5.0.5 (Illumina), analysis was done using QIIME2 (version 2020.6 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Paired end sequencing with 150bp sequences was done on the NovaSeq-6000 platform (Illumina).
-
bioRxiv - Genetics 2022Quote: ... the sequence at the target codon in each isolate was also determined by Illumina sequencing (Supplementary File 1) ...
-
bioRxiv - Microbiology 2021Quote: ... Sequences were demultiplexed and filtered for read quality using Bcl2Fastq conversion software (Illumina, Inc.). In total ...
-
bioRxiv - Immunology 2019Quote: ... The sequences in the MA dataset were obtained from a re-sequencing by Illumina MiSeq (34 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 150-bp paired-read sequences were obtained using the HiSeq X Ten sequencer (Illumina) in Macrogen Japan Corp.
-
bioRxiv - Microbiology 2021Quote: ... Short sequence reads were generated with a NovaSeq 6000 instrument (Illumina, San Diego, CA). To ensure a very high depth of coverage ...
-
bioRxiv - Cell Biology 2020Quote: ... Five to ten million single end sequence reads were obtained on a HiSeq2500 (Illumina) with 150-bp read length.
-
bioRxiv - Immunology 2020Quote: ... and indexed using Nextera XT P5 and P7 index sequences (Illumina, San Diego, CA) for Illumina sequencing according to the manufacturer’s instructions (10 cycles) ...
-
bioRxiv - Immunology 2021Quote: ... These sequences were screened to select those without ambiguous residues and generated from Illumina sequencing technologies using an in-house sequence QC script ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene-specific primers were designed based upon sequences obtained from the sequenced transcriptome (Illumina) of D ...
-
bioRxiv - Cancer Biology 2022Quote: ... The reference genome sequences for human (hg38) and mouse (mm10) were downloaded from Illumina iGenomes (www.support.illumina.com/sequencing/sequencing_software/igenome.html) ...
-
bioRxiv - Genomics 2022Quote: ... Paired end 150 bp sequence reads were generated on a NovaSeq 6000 System (Illumina) at the HudsonAlpha Genome Sequencing Center (Huntsville ...
-
bioRxiv - Plant Biology 2023Quote: ... 150-bp paired-read sequences were obtained using the HiSeq X Ten sequencer (Illumina) at Macrogen Japan Corp.
-
bioRxiv - Microbiology 2023Quote: The sequences of the KSHVLRI BAC and of BAC16 genomes were verified by Illumina deep sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... The sequence libraries were generated by TruSeq RNA Sample Prep Kit (Illumina, CA, USA) and sequenced in Illumina HiSeq 1500 platform ...
-
bioRxiv - Neuroscience 2023Quote: ... Paired-end 100bp sequences were generated over 1 lane by NovaSeq6000 using S4FC (Illumina).
-
bioRxiv - Genomics 2023Quote: ... Sequence read data were processed and converted to short-read FASTQ format by Illumina BaseSpace analysis software (v2.0.13) ...
-
bioRxiv - Genetics 2023Quote: ... five forward and five reverse primers contain Nextera transposase adapter sequences (Illumina Document#1000000002694) “TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG” (read 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Raw sequence reads were demultiplexed into sample-specific fastq files (bcl2fastq program v2.20.0.422, Illumina). The resulting fastq files were processed as follows ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TruSeq RNA Single Indexes Set A and B (Illumina, # 20020492 and 20020493). Library qualities and sizes were checked with the TapeStation 4200 and then quantified using the KAPA Library Quantification Kit for Illumina platforms (Kapa Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... The B-allele frequency and Log R ratio values were downloaded from Illumina GenomeStudio and processed and plotted using the GWASTools package in R (v3.6.1 ...
-
bioRxiv - Microbiology 2023Quote: ... with 6 nucleotides library indexes (DNA Single Indexes Set A or B, Illumina). To achieve sufficient variability during the first five sequencing cycles ...
-
bioRxiv - Plant Biology 2020Quote: ... after filtering 81,416,218 16S rRNA raw reads for known contaminants (Illumina adapter sequence and PhiX), primer sequences were trimmed from the 5’ ends of both forward and reverse reads ...
-
bioRxiv - Microbiology 2020Quote: ... Sequence data can be found on NCBI under the SRA accession PRJNA608686 (raw Illumina reads) and MT742785 (assembled 18S rRNA sequence).
-
bioRxiv - Cancer Biology 2021Quote: ... sequence data was demultiplexed and Fastq files generated using bcl2fastq v2.20.0.422 file converter from Illumina. The RNAseq data has been deposited in NCBI’s Gene Expression Omnibus (Edgar et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... The raw read & quality check were done by transforming sequence images the BaseCaller software (Illumina) to BCL files ...
-
bioRxiv - Bioengineering 2020Quote: ... Validation of sequence quality was performed using the BaseSpace cloud computing service supported by Illumina (BaseSpace Sequence Hub ...
-
bioRxiv - Microbiology 2019Quote: ... Viral titers were determined by plaque assay in MDCK cells and sequences confirmed by Illumina MiSeq sequencing.
-
bioRxiv - Molecular Biology 2019Quote: ... The fluorescent images were processed to nucleotide sequences using the analysis Pipeline supplied by Illumina.
-
bioRxiv - Molecular Biology 2019Quote: ... Pair-end sequences with 200 bp were obtained from these cDNA libraries through Hiseq2000 (Illumina). The raw reads were deposited in DDBJ Sequence Read Archive (accession number ...
-
bioRxiv - Developmental Biology 2019Quote: Sequences were matched to samples by barcode and aligned to the target regions (BaseSpace, Illumina). Variants were called using Genome Analysis Toolkit (GATK ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and paired-end sequences of 101 bp were determined using HiSeq 2500 (Illumina, CA, USA). All experimental procedures were approved by the Institutional Animal Welfare and Animal Care Committee of PRI (No ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and paired-end sequences of 151 bp were determined using HiSeq X (Illumina, CA, USA).