Labshake search
Citations for Illumina :
1 - 50 of 819 citations for Chemokine C X C Motif Ligand 3 CXCL3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... The Hi-C library was sequenced on a HiSeq X Platform (Illumina, CA, USA) to a coverage of 60X ...
-
bioRxiv - Microbiology 2023Quote: ... C and D (Illumina). Amplicon concentration across samples was normalized to 200 ng/μl using the Qubit high sensitivity dsDNA assay before pooling ...
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Microbiology 2021Quote: ... 9) DC3000 − C (Illumina only), 10 ...
-
bioRxiv - Genomics 2021Quote: ... and (3) 134 Gb (~100× depth) chromosome conformation capture sequencing (Hi-C) data (sequenced by Illumina platform).
-
bioRxiv - Genomics 2020Quote: ... and Hi-C sequencing (Illumina sequencing). The tissue samples were stored in liquid nitrogen before sequencing ...
-
bioRxiv - Genomics 2021Quote: ... platform = c(”Illumina Human Methylation 450”), and sample.type = c(”Primary solid Tumor”,”Solid Tissue Normal”) ...
-
bioRxiv - Genomics 2019Quote: Raw Nanopore and Hi-C (Illumina) reads have been deposited in the NCBI SRA and are under the BioProject (PRJNA565796) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... as well as Hi-C (Illumina) chromatin interaction data ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Hi-C sequencing was performed by Illumina HiSeq 2500 platform ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... according to the manufacturer’s instructions and stored in 10 mM Tris buffer at pH 8 and -80 ⁰C until paired-end reads of 2 x 150 bp were sequenced on a NextSeq 500/550 (Illumina, San Diego, CA) at the University of Bristol Genomics Facility ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and a single substitution error in the coding region was manually edited (c.14475 C>A, G184W) based on strong support from Illumina reads (data not shown) ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 sec at 62°C and a final extension step of 5 min at 62°C) and sequenced using the NOVASeq platform (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... 19bp single end sequencing (Illumina-C HiSeq 2500).
-
bioRxiv - Cancer Biology 2021Quote: ... All Hi-C libraries were sequenced by Illumina sequencing ...
-
bioRxiv - Genomics 2023Quote: ... and Hi-C (Illumina NovaSeq 6000, 2×150bp) for chromosome-level scaffolding (Fig ...
-
bioRxiv - Genomics 2021Quote: ... and Reverse primer (5’-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GGA CTA CHV GGG TAT CTA ATC C-3’) with Illumina sequencing adaptors (Illumina, California, USA). The purified PCR products were then subjected to a multiplexing process using Nextera XT Index kit (Illumina ...
-
bioRxiv - Systems Biology 2019Quote: ... Set C: indexes 25–36 (Illumina, RS-200-0036), Set D ...
-
bioRxiv - Pathology 2024Quote: ... aphidicola (C, D) based on SNPs identified from Illumina sequencing ...
-
bioRxiv - Genomics 2022Quote: ... The Hi-C library was amplified using PE primers (Illumina) with 10 PCR amplification cycles ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... equimolar amounts of the libraries underwent a c-Bot (Illumina) bridge PCR followed by single end sequencing for 77 cycles on an Illumina Hiseq2500 ...
-
bioRxiv - Genomics 2023Quote: ... The Hi-C library was amplified using PE primers (Illumina) with 10 PCR amplification cycles ...
-
bioRxiv - Genomics 2023Quote: ... Illumina Nextera DNA Unique Dual Indexes Set C (Illumina, 20027215) were added and amplified (12 cycles ...
-
bioRxiv - Genomics 2019Quote: ... Hi-C libraries were prepared for sequencing on HiSeq 4000 (Illumina). After sequencing ...
-
bioRxiv - Genomics 2019Quote: ... and the Hi-C libraries were paired-end sequenced (HiSeq 2500, Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... The pool was adjusted to 10pM for clustering on C-Bot (Illumina) and then sequenced Paired-End 101 bases using the HiSeq SBS Kit v4 (Illumina ...
-
bioRxiv - Systems Biology 2023Quote: ... 62 °C for 5 min) using Nextera i5/i7 indexing primers (Illumina) and 2x KAPA HiFi HotStart ready-mix (KAPA Biosystems) ...
-
bioRxiv - Genomics 2019Quote: ... and the Promoter CHi-C libraries were paired-end sequenced (HiSeq 2500, Illumina).
-
bioRxiv - Genomics 2021Quote: We downloaded publicly-available Hi-C data from human prefrontal cortex tissue23,24 (Illumina HiSeq 2000 paired-end raw sequence reads ...
-
bioRxiv - Genomics 2020Quote: ... Hi-C libraries were paired-end sequenced on a NovaSeq 6000 system (Illumina). Raw data were processed with the ENCODE 4 pipeline for Hi-C according to ENCODE 4 standards (https://www.encodeproject.org/documents/75926e4b-77aa-4959-8ca7-87efcba39d79/).
-
Dual symbiosis in the deep-sea hydrothermal vent snail Gigantopelta aegis revealed by its hologenomebioRxiv - Genomics 2020Quote: ... The Hi-C library was sequenced on a NovaSeq 6000 platform (Illumina, USA) and generated reads with a length of 150 bp ...
-
bioRxiv - Cancer Biology 2022Quote: ... Hi-C libraries were sequenced 2×150bp on a NovaSeq 6000 instrument (Illumina). Juicer were used to process raw reads and generate Hi-C contact matrices (.hic files) ...
-
bioRxiv - Genetics 2022Quote: ... the products from each sample were bulked and applied to c-Bot (Illumina) bridge PCR followed by sequencing on Illumina Hiseq2500 ...
-
bioRxiv - Plant Biology 2023Quote: ... Hi-C libraries were sequenced on Illumina NextSeq500 (Illumina, San Diego, CA, USA) platform using platform using High Output Kit v2.5 (150 Cycles).
-
bioRxiv - Genomics 2023Quote: ... The Hi-C library was sequenced on a NovaSeq 6000 platform (Illumina, USA) and generated reads with a length of 150 bp producing 32.08 Gbp of data in total (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Microbiology 2022Quote: ... Libraries were pooled at 3 nM and sequenced on a HiSeq X instrument (Illumina, San Diego, CA) to generate 150 bp paired-end reads (Psomagen ...
-
bioRxiv - Genetics 2022Quote: ... Hi-C libraries were paired-end sequenced (61bp+61bp) on a NovaSeq 6000 (Illumina).
-
bioRxiv - Genomics 2020Quote: ... The resulting Hi-C libraries were paired-end sequenced on a NovaSeq6000 platform (Illumina) to >500 million read pairs per replicate (Table S1) ...
-
bioRxiv - Genomics 2023Quote: ... The transposition reaction was incubated for 30 min or 1h at 37◦C (Illumina Tagment DNA Enzyme and Buffer kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were indexed using the IDT for Nextera Unique Dual Indexes Set C (Illumina). Then ...
-
bioRxiv - Developmental Biology 2024Quote: ... and then treated for 30 minutes at 37°C with Tn5 transposase (Illumina, 20034197). The DNA was extracted using DNA Clean and Concentrator 5-kit (Zymo Research ...
-
bioRxiv - Biochemistry 2021Quote: ... Retromer ligands were identified by sequencing the final enriched cDNA using a MiSeq sequencer (Illumina).
-
Targeted rescue of synaptic plasticity improves cognitive decline after severe systemic inflammationbioRxiv - Neuroscience 2021Quote: ... 58°C on two Illumina MouseRef-8 v2.0 Expression BeadChips (Illumina, San Diego, CA, USA). Post-hybridization data read-out ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Genomics 2019Quote: ... Hi-C libraries were sequenced on a NextSeq 550 apparatus (2 × 75 bp, paired-end Illumina NextSeq with the first ten bases acting as barcodes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Hi-C libraries were sequenced on a NextSeq 550 sequencer (2×75 bp, paired-end Illumina NextSeq with the first ten bases acting as barcodes50).