Labshake search
Citations for Illumina :
451 - 500 of 819 citations for Chemokine C X C Motif Ligand 3 CXCL3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... The single-cell RNA sequencing (scRNA-seq) libraries were sequenced on the HiSeq X Ten platform (Illumina, USA) at Macrogen (Republic of Korea) ...
-
bioRxiv - Genomics 2020Quote: ... Libraries have subsequently been sequenced one sample per lane on HiSeq4000 (Illumina; paired-end 26 x 74 bp)
-
bioRxiv - Microbiology 2021Quote: ... Barcodes were ligated and libraries were sequenced using MiSeq V3 (300bp x 2) chemistry (Illumina, San Diego, CA). Sequencing was performed at the Centre for the Analysis of Genome Evolution and Function (Toronto ...
-
bioRxiv - Genomics 2020Quote: ... The constructed libraries were sequenced at ∼6.10× coverage on the HiSeq X Ten platform (Illumina, San Diego, USA) by Annoroad Gene Technology Co. ...
-
bioRxiv - Genomics 2020Quote: ... and sequenced with 150 bp paired end reads on an Illumina HiSeq X Ten platform (Illumina, United States). This generated 625,914,906 reads ...
-
bioRxiv - Genomics 2021Quote: ... cDNA libraries were loaded on individual flow cell lanes and sequenced using a HiSeq X Ten platform (Illumina) at Macrogen (Seoul ...
-
bioRxiv - Developmental Biology 2020Quote: ... The libraries were sequenced on a Hiseq X-ten instrument set for paired-end 150 bp sequencing (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... The DNA library was paired-end sequenced (2 x 151 bp) on a NovaSeq S4 system (Illumina, USA). A long-read sequencing library was prepared according to the SQK-LSK110 protocol (ONT ...
-
bioRxiv - Microbiology 2023Quote: ... The 16S rRNA gene amplicons were sequenced using the 2 x 300 bp paired-end MiSeq protocol (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... Samples were then amplified and paired-end sequencing (2 x 41 cycles) was performed on NextSeq 500 (Illumina). See Supplementary Table 2 for sequenced ATAC-seq samples.
-
bioRxiv - Biophysics 2023Quote: ... at the UNMC Sequencing core using miSeq reagent kit v3 (600 cycles) 2 x 300 read length (Illumina). The total number of reads were 1-2 million reads per sample.
-
bioRxiv - Genomics 2024Quote: Pooled libraries were sequenced at 150 bp paired ends using HiSeq X Ten (Illumina, San Diego, CA, U.S.) by Macrogen Japan (Tokyo ...
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Cell Biology 2020Quote: ... Whole genome sequencing was performed with 1 μg of the digested DNA using a HiSeq X Ten Sequencer (Illumina) at Macrogen (South Korea).
-
bioRxiv - Genomics 2019Quote: ... The libraries were sequenced with paired-end 150-bp reads on Hiseq X-ten or Novaseq 6000 platform (Illumina).
-
bioRxiv - Microbiology 2020Quote: The DNA library was prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina according to the manufacturer’s instructions and shotgun-sequenced using the Illumina MiSeq platform with a read length of 2 x 150bp (Illumina). In total ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries from four 10x channels were pooled together and sequenced on one lane of an Illumina HiSeq X (Illumina) by the Genomics Platform of the Broad Institute.
-
bioRxiv - Microbiology 2020Quote: ... One paired end sequencing run (2 x 301) was completed on an Illumina MiSeq instrument (Illumina, San Diego, CA) using v3 chemistry ...
-
bioRxiv - Microbiology 2020Quote: ... The genomic libraries were sequenced as 2 x 150 bp reads on Illumina Novaseq 6000 (Illumina, San Diego, CA) at UC San Francisco Sequencing Core to generate ~2.17 Gb of sequence ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing of a paired-end 2 × 150 bp mode on a HiSeq X system (Illumina, San Diego, CA, USA) was done by BGI Japan (Kobe ...
-
bioRxiv - Genetics 2022Quote: ... sequence reads were mapped to the mouse reference genome GRCm38/mm10 (iGenomes, Illumina; chromosomes 1-19, X, Y, M) using the Rsubread v1.28.1 package in R v3.4.4 ...
-
bioRxiv - Immunology 2020Quote: ... using the NucleoSpin RNA Kit from Macherey&Nagel according to the manufacturer’s instructions and sequenced on a MiSeq paired-end run (75 x 75, v3; Illumina). Samples were aligned to the mm10 transcript reference using TopHat2 ...
-
bioRxiv - Microbiology 2021Quote: ... normalized pools of all samples were sequenced on an Illumina MiSeq using the 2 x 150bp sequencing kit (Illumina). This Whole Genome Shotgun project has been deposited with the links to BioProject accession number PRJNA434045 in the NCBI BioProject database (http://www.ebi.ac.uk/ena/data/view/PRJEB21817 ...
-
bioRxiv - Microbiology 2021Quote: ... and sequenced on an Illumina HiSeq 2500 using TruSeq 2 x 100 base pair (bp) paired-end chemistry (Illumina) by UAGC.
-
bioRxiv - Microbiology 2021Quote: ... Paired-end Illumina sequencing (2 x 150 bp) was performed for each metagenomic library on Hiseq Xten instruments (Illumina).
-
bioRxiv - Genomics 2020Quote: ... These DNA libraries were clustered on a cBot Cluster Generation System using HiSeq X HD PE Cluster Kit (Illumina) and sequenced on an Illumina HiSeq X Ten platform at Novogene ...
-
bioRxiv - Microbiology 2022Quote: ... Paired-end sequencing (2×150 bp) and PCR-free whole genome sequencing was performed on a HiSeq X (Illumina) 54 ...
-
bioRxiv - Pathology 2023Quote: ... Barcoded libraries from each experimental sample were combined in equimolar concentrations of 1.5 pM prior to sequencing at 75bp x 1 (single-end) read metric on a NextSeq 550 (Illumina) system.
-
bioRxiv - Bioengineering 2023Quote: The libraries were paired-end sequenced on Illumina HiSeq X Ten sequencer for 150 cycles (Illumina, San Diego, USA) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... and 1.25µM indexing primers (Ad1_noMX primer and Ad2.x indexing primer 45 or IDT for Illumina dual index primers (Illumina, Nextera DNA UD Indexes Set A Ref 20025019) ...
-
bioRxiv - Genomics 2022Quote: ... and sequenced on a NovaSeq 6000 instrument (NovaSeq 6000 S2 Reagent Kit (Illumina, 20012861, PE 2 x 75 cycles)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... following the manufacturer’s protocols and sequenced using the 2 x 75 bases paired-end protocol on a NextSeq550 instrument (Illumina). For differential expression analysis ...
-
bioRxiv - Microbiology 2024Quote: ... A 2 x 300 bp paired-end sequencing was performed on an Illumina MiSeq platform (Illumina, Inc., Sandiego, CA).
-
bioRxiv - Molecular Biology 2023Quote: ... Pelleted nuclei were incubated in transposase reaction mix (1 X TD reaction buffer, 2.5 µl Tn5 transposase (Nextera, Illumina)) for 30 min at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... Sequencing was performed with 2 x 100 bp read length and 50 million clusters/probe on NovaSeq 6000 (Illumina). Normalization data was provided by CeGat ...
-
bioRxiv - Genomics 2022Quote: ... Libraries for resequencing at high coverage (15 or 30x) were produced with an average insert size of 550 bp and sequenced on a HiSeq X instrument (Illumina). All libraries were sequenced at Edinburgh Genomics (Edinburgh Genomics ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end read sequencing (2×150 bp) was performed on the Illumina HiSeq X (Illumina, Inc., San Diego, CA, USA) using the Chromium library.
-
bioRxiv - Microbiology 2019Quote: ... and was sequenced from paired ends using 500 cycles with the HiSeq 2500 (2 x 250 bp) system (Illumina, USA).
-
bioRxiv - Genomics 2019Quote: ... Each library was sequenced using single-end 75 bp reads (120-140 x 106 reads per sample) in a NextSeq500 System (Illumina).
-
bioRxiv - Plant Biology 2019Quote: ... The sequencing was performed with 2 x 100 bp read length of the flow cell loaded on a HiSeq 2500 sequencing system (Illumina).
-
bioRxiv - Bioengineering 2020Quote: ... The barcoded amplicon samples were then sent to the UCLA Technology Center for Genomics & Bioinformatics for multiplex sequencing with 2 x 300 paired-end configuration in a single-lane flow cell of MiSeq instrument (Illumina). Fastq paired-end raw data were filtered ...
-
bioRxiv - Genomics 2020Quote: PDT and ATAC libraries were pooled and paired-end sequenced (2 x 34 cycles) using Nextseq High Output Cartridge kits on a Nextseq 550 machine (Illumina). Raw sequencing data were demultiplexed with CellRanger-ATAC mkfastq ...
-
bioRxiv - Genomics 2021Quote: ... ChIP-seq libraries were prepared using the ThruPLEX DNA-seq Kit (Rubicon) and sequenced paired-end 2 x 100bp on the HiSeq 2500 (Illumina).