Labshake search
Citations for Illumina :
101 - 150 of 157 citations for CKLF Like MARVEL Transmembrane Domain Containing 7 CMTM7 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclei were then resuspended in 50 μL transposition reaction mix containing 25 μL 2X Tagment DNA buffer (Illumina), 2.5 μL Tn5 transposase (Illumina) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library of polyA-containing mRNA (350 bp size) was prepared using TruSeq Stranded mRNA Library Prep kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: Adapter sequences were trimmed from the raw reads using fastq-mcf (ea-utils v1.1.2, with default parameters and using a list containing the common Illumina adapters) and the quality of the cleaned reads was checked with FastQC (v0.1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Supernatant was discarded and pellets resuspended in 20 μl ATAC reaction buffer containing 10 μl 2x transposase buffer and 2.5 μl Tn5 enzyme (Illumina). Samples were incubated at 37 °C for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... nuclei were extracted from cells and treated with transposition mixture containing Nextera Tn5 Transposase for (Illumina, FC-121-1030). Transposed fragments were then purified using QIAGEN MinElute columns (QIAGEN ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA libraries containing pooled barcoded samples was run across two lanes of a HiSeq400 (Illumina, San Diego, CA, USA) on two separate runs for 150 bp paired-end reads (http://dnatech.genomecenter.ucdavis.edu/) ...
-
bioRxiv - Microbiology 2022Quote: We sequenced the pooled sample containing PCR products using Illumina MiSeq technology (Illumina Reagent Kit v2, 500 reaction kit) at the Center for Bioinformatics and Genomics at Indiana University ...
-
bioRxiv - Cell Biology 2022Quote: ... Single cells were dispatched into a 96-plate well containing 5μL 1x lysis buffer containing Murine RNase inhibitor (NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... 0.8 ul of each normalized sample was mixed with 2.4 ul of tagmentation mix containing Tn5 Tagmentation enzyme (20034198, Illumina) and then incubated at 55°C for 12 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... bead-bound complexes were resuspended in tagmentation mixture (25µL reaction containing 1 µL of enzyme in 1X buffer, Illumina) and incubated at 37°C for 25minutes ...
-
A gene desert required for regulatory control of pleiotropic Shox2 expression and embryonic survivalbioRxiv - Developmental Biology 2023Quote: ... 50’000 nuclei were then pelleted at 500 RCF for 10 min at 4°C and resuspended in 50 pL transposition reaction mix containing 25 pL Nextera 2x TD buffer and 2.5 pL TDE1 (Nextera Tn5 Transposase; Illumina) (cat ...
-
bioRxiv - Neuroscience 2023Quote: ... The pellet was resuspended in 200uL of Transposition Mix (1x TD buffer containing 20 U/mL Superase-In RNase Inhibitor, 40 U/mL RNasin ribonuclease inhibitor and 1.25 µl of Illumina Tagment DNA TDE1 Enzyme per every 100 000 nuclei ...
-
bioRxiv - Microbiology 2023Quote: ... we then sought to remove BioProjects containing pyrosequencing data and other sequencing instruments that use processes dissimilar from Illumina sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... and PCR products were gel purified and stored in 50 μL buffer containing 10mM Tris (pH 8.0) until submission to TruSeq® DNA library preparation (Illumina) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Nuclei were centrifuged at 500 g for 10 min and immediately resuspended in 25 µl of buffer containing 2.5 µl of Tn5 transposase (Illumina, #15027865) for a 30 min incubation at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... Individual sequencing barcodes were added to each sample by amplifying the entire 40 μL elution in a 100 μL Q5 NEBNext reaction with 0.5 μM of TruSeq_Universal_Adapter primer and a reverse primer containing a unique 8 bp index (Illumina_Multiplex, Supplementary Table 14) for sample demultiplexing post-sequencing ...
-
bioRxiv - Genomics 2019Quote: ... and the transposition was performed by resuspension of nuclei in 50 µL of Transposition Mix containing 1X TD Buffer (Illumina) and 2.5 µL Tn5 (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... containing 5µL of each index primer (Nextera XT Index kit v2 set A, B and D; Illumina, San Diego, CA), 10ul of purified PCR products (0-20ng/µL ...
-
bioRxiv - Immunology 2019Quote: ... and a mixture of 8 VH family and IgM-specific primers (listed below) containing 5’ adaptors to allow barcoding by the Illlumina TruSeq multiplex pcr kit (Illumina). Resulting PCR products were subjected to 10 cycles of PCR using Illumina TruSeq indexing primers ...
-
bioRxiv - Genetics 2020Quote: ... The cell pellet was resuspended with 50 μl transposition mix containing 25 μl 2X TD buffer (Illumina FC-121-1030), 3.5 μl Tn5 transposase (Illumina FC-121-1030) ...
-
bioRxiv - Microbiology 2022Quote: ... The primers Uni530F and Uni907R (Nunoura et al., 2012) containing Illumina TruSeq adapter sequences (Illumina Inc., San Diego, CA, USA) were used for PCR ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Two paired-end Illumina libraries containing 250 and 600 bp insertions (DRR029525 and DRR029526) were constructed using a TruSeq DNA Sample Prep Kit (Illumina). Three mate-pair libraries with 3000 ...
-
bioRxiv - Microbiology 2022Quote: ... Two clones that produce the Y113F substituted Gp8 were propagated twice on strains containing only pCas9-guide for further selection and genomes were sequence verified by Illumina sequencing as described below.
-
bioRxiv - Genomics 2019Quote: ... 5 mM MgCl2) containing 1 μl Tn5 transposase from the Nextera DNA Library Prep Kit (15028212, Illumina, San Diego, USA) and incubated at 37°C for 10min ...
-
bioRxiv - Developmental Biology 2019Quote: ... lysed and mixed with 50 µl of transposition reaction mix containing Tagment DNA Enzyme (Nextera DNA Library Preparation Kit, Illumina) and 0.2% Digitonin ...
-
bioRxiv - Molecular Biology 2021Quote: ... SmRNA libraries were prepared as described above using 800 ng of RNA containing 40 ng Drosophila melanogaster RNA as spike-in and sequenced with the Novaseq 6000 system (Illumina) to 40 – 90 million reads per sample.
-
bioRxiv - Genomics 2019Quote: ... Sequencing libraries of A and B containing 6 bp indexes were prepared using the TruSeq RNA sample prep kit (Illumina) following a modification of the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... The final libraries containing barcoded single-cell transcriptomes were sequenced at 100 cycles using the S2 flowcell on the Novoseq 6000 system (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... In the first round of PCR we used primers that align to Illumina Truseq Read 1 primer site located directly upstream of the barcode in the lentiviral backbone and a primer annealing downstream of the barcode containing an overhand with Illumina Truseq Read 2 sequence (see ‘Illumina barcode sequencing 1st round PCR primers’ in the Supplemental Table 1) ...
-
bioRxiv - Microbiology 2022Quote: ... followed by polymerase chain reaction with primers containing Illumina adapters to construct DNA libraries for paired-end sequencing on a NextSeq machine (Illumina).
-
bioRxiv - Microbiology 2023Quote: Amplification of the V4 region of the 16S rRNA gene was carried out in triplicates with primers containing illumina adapters (515F-Illumina 5’-TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG GTG CCA GCM GCC GCG GTA A-3’ and 806R-Illumina 5’-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GGG ACT ACH VGG GTW TCT AAT-3’) ...
-
bioRxiv - Genetics 2023Quote: ... The nuclei was resuspended in the transposition reaction mix containing 25 μL 2x TD Buffer (Illumina, cat #FC-121-1030), 2.5 μL Tn5 Transposase (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... Nuclei were mixed with 50 µl of transposition reaction mix containing Tagment DNA Enzyme 1 (Nextera DNA Library Preparation Kit, Illumina). The transposition reaction was carried out at 37°C and 600rpm for 30 min ...
-
bioRxiv - Bioengineering 2023Quote: ... primers were designed containing a universal linker sequence allowing amplicons for incorporation indexes and sequencing primers by Nextera XT Index kit (ILLUMINA); and 16S rRNA gene universal primers (Klindwoth2013) ...
-
bioRxiv - Immunology 2024Quote: ... After centrifugation at 500ξ g for 5min at 4°C, the cell pellets were resuspended in tagmentation-mix (containing Tagment DNA buffer, Tagment DNA Enzyme (Illumina), Digitonin (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... The crude nuclear prep was then centrifuged and resuspended in 1x TD buffer containing the Tn5 transposase (Illumina FC-121-1030). The transposition reaction was incubated at 37C for 30 minutes and immediately purified using the Qiagen MinElute kit ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were collected by centrifugation and subjected then to transposition reaction in 1x Tagment DNA buffer containing 5% Tn5 Transposase (Illumina, 20034197), 0.1% Tween-20 ...
-
bioRxiv - Microbiology 2019Quote: ... containing 20% phiX DNA was denatured and sequenced (2 × 250 nt) on an Illumina MiSeq instrument (Illumina Inc, San Diego, CA) using a v2 500 cycle kit ...
-
bioRxiv - Immunology 2022Quote: ... The remaining lysis supernatant containing the nuclei were immediately placed into a transposase reaction using the Tagment DNA TDE1 enzyme kit (Illumina 20034197) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The result of this processing was a single multisample VCF file containing SNP and INDEL calls across all lines of the MIKK panel (MIKK Illumina callset).
-
bioRxiv - Molecular Biology 2023Quote: ... and the nuclei resuspended in 47.5μl of Tagmentation buffer (containing 25μl of 2x Tagmentation buffer from Illumina and 22.5μl of water) before adding 2.5μl of Tn5 enzyme (Illumina Nextera kit ...
-
bioRxiv - Genomics 2020Quote: ... Genomic DNA libraries containing 300∼500 bp fragments were constructed using Nextera XT DNA Library Preparation Kit (Illumina Inc., San Diego, USA). The WGS was performed using 100 bp paired-end sequencing protocol under Illumina platform using HiSeq4000 sequencer (Macrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Genetics 2020Quote: ... 0.02 µM of specific adapters for the Illumina technology (containing the barcode sequences and complementary to the Illumina ™ primers for sequencing) were connected to the fragments ends generated in the digestion ...
-
bioRxiv - Plant Biology 2023Quote: ... The nuclei pellet was then immediately resuspended in 25 μ L of 2x tagmentation buffer containing 2 μ L of TDE1 (Illumina). The reaction was placed at 37C for 30 minutes with gentle mixing three times ...
-
bioRxiv - Microbiology 2021Quote: Bacterial 16S V3-V4 regions were amplified by PCR using universal primers derived from DBact-0341-b-S-17 and S-D-Bact-0785-a-A-21 (24) containing unique adapters for the Nextera XT indexing kit according to the manufacturer’s instructions (Illumina Inc., San Diego, CA). Fungal ITS2 regions were amplified using separate unique adapter primers derived from IST3_KYO1 and IST4_KYO1 (25) ...
-
bioRxiv - Immunology 2020Quote: ... PCR amplification and index incorporation were performed in a 50 μl reaction containing 5 μl of forward and reverse index primers (Illumina Nextera Index Kit), 15 μl NPM ...
-
bioRxiv - Genomics 2023Quote: ... The pelleted nuclei were gently resuspended with 50 µl of transposition reaction containing 25 µL 2X Tagmentation buffer (Illumina Cat FC-121-1030), 5 µL Tn5 transposase (Illumina Cat FC-121-1030 ...
-
bioRxiv - Genomics 2023Quote: ... 4 μl of 1 ng amplicon DNA was combined with a mix containing 1 μl of Amplicon Tagment Mix (Illumina, FC- 131-1096) and 5 μl of Tagment DNA Buffer (Illumina ...
-
bioRxiv - Cancer Biology 2020Quote: ... converted to cDNA and ligated to sequencing adaptors containing indexes using the Illumina TruSeq stranded mRNA sample preparation kit (Cat. #RS-122-2101, Illumina, Inc., San Diego, CA). The molar concentrations of the indexed libraries were measured using the 2100 Agilent Bioanalyzer (Agilent Technologies ...