Labshake search
Citations for Illumina :
401 - 450 of 991 citations for 8 DECYLOXYPYRENE 1 3 6 TRISULFONIC ACID TRISODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... cells and CD14+ monocytes were generated using the SureCell WTA 3′ Library Prep Kit for the ddSEQ System (20014280, Illumina) with the following modifications ...
-
bioRxiv - Physiology 2021Quote: Sodium-bisulfite treated DNA of nine samples (6 dHT vehicle treated and 3 dHT drug treated) was subjected to measure global DNAm by Infinium Mouse methylation BeadChip array (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... single-cell barcoded cDNA libraries were generated with 10X Chromium preparation system using the Chromium Single Cell 3’ Library & Gel Bead Kit v3 and sequenced by Illumina HiSeq ...
-
bioRxiv - Microbiology 2020Quote: ... The obtained partitions were further processed using the Chromium Single Cell 3’ Reagent Kit (version 2, 10x Genomics) to generate Nextera XT sequencing libraries that were sequenced on a HiSeq3000 (Illumina), using a single flow cell lane for each library.
-
bioRxiv - Evolutionary Biology 2020Quote: ... and mate-pair libraries of 3 kb insert size were prepared using the Nextera Mate Pair Sample Preparation Kit (cat. No. FC-132-1001, Illumina). We then assessed library quality using the HS DNA Kit (Agilent ...
-
bioRxiv - Developmental Biology 2021Quote: ... 25 mL of 2x NEBNext Ultra II Q5 Master Mix, 3 mL of 10 mM Universal PCR primer from Illumina, 3 mL of 10mM Index PCR primer and 9 mL of nuclease-free water and amplified for 10 cycles (98C for 10 s ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... The rRNA-depleted samples were used for TruSeq Stranded RNA Sample Prep kit to produce 5′ to 3′ strand-specific cDNA libraries (Illumina). A TruSeq SBS sequencing kit version 3 (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... the two plasmid DNA mixtures were sequenced using an Illumina MiSeq instrument with reagent kit version 3 (2x 300 cycles) as recommended by the manufacturer (Illumina)) ...
-
bioRxiv - Immunology 2020Quote: ... Samples were prepared using the Lexogen 3’ QuantSeq mRNA-seq Library Prep Kit FWD (Lexogen) and sequenced on the Illumina NovsSeq 6000 system (Illumina).
-
bioRxiv - Immunology 2020Quote: ... Single cell libraries from sorted samples were generated using a UMI-based droplet-partitioning platform with the Chromium single cell 3’ library and gel bead kit v2 and v3 (10X Genomics) and then sequenced using a NovaSeq S2 (Illumina). Technical information relevant to the scRNA-Seq samples is found in Table S3.
-
bioRxiv - Genomics 2021Quote: Single-cell libraries were prepared from 12,000 cells per time point (Figure 1A) using the SureCell WTA 3’ Library Prep Kit for the ddSEQ System (Illumina). Cells with viability >90% were collected by detaching cells from plates using Trypsin-EDTA 0.25% ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA from the barcoded cells was subsequently reverse-transcribed and sequencing libraries constructed with reagents from a Chromium Single Cell 3’ v3 reagent kit (10x Genomics) and sequenced with the NovaSeq system (Illumina).
-
bioRxiv - Genomics 2022Quote: ... Micro-C libraries (at least 3 per each biological replicate) that passed QC criteria were pooled and paired-end sequenced on a NovaSeq6000 platform (Illumina) to >600 million read pairs per replicate (Table S1) ...
-
bioRxiv - Immunology 2022Quote: Samples were prepared using a Chromium Single Cell 3’ Reagent Kit (10x Genomics) and run on a NovaSeq S4-200 cell (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... cells were harvested and prepared with 10X Chromium Single Cell 3’ Reagents V3 and sequenced on a NovaSeq 6000 (Illumina) using a S2 flow cell at 2 × 100bp ...
-
bioRxiv - Developmental Biology 2022Quote: ... Indexed libraries were prepared using the Chromium Single Cell 3’ Library & Gel Bead Kit v2 (10X Genomics; PN-120237) and sequenced on a NovaSeq 6000 (Illumina) to obtain a sequencing depth of 1.50E+08 paired-end reads per library ...
-
bioRxiv - Cell Biology 2022Quote: ... 13177 cells from a mixture of 3 diabetics) were captured for scRNA-seq library preparation and paired-end sequencing using the NovaSeq 6000 SP100 (Illumina) carried out at the GCTU of Queen’s University Belfast ...
-
bioRxiv - Microbiology 2023Quote: Amplification of the V4 region of the 16S rRNA gene was carried out in triplicates with primers containing illumina adapters (515F-Illumina 5’-TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG GTG CCA GCM GCC GCG GTA A-3’ and 806R-Illumina 5’-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GGG ACT ACH VGG GTW TCT AAT-3’) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA-seq libraries for yeast (n = 3 per tested condition) and neuroblastoma cells (n = 3 per tested condition) were prepared according to the TruSeq stranded mRNA protocol (Illumina) and 101-bp single-end reads produced on an Illumina NovaSeq 6000 instrument ...
-
bioRxiv - Cancer Biology 2023Quote: ... with library preparation using the Chromium Next GEM Single Cell 3’ Kit (10x Genomics, PN-1000268) and sequencing was performed on the NovaSeq 6000 (Illumina) by the WSU GSC ...
-
bioRxiv - Cancer Biology 2023Quote: ... Spatially tagged cDNA libraries were constructed with the 10x Genomics Visium Spatial Gene Expression 3’ Library Construction V1 Kit and then sequenced on Novaseq (Illumina)
-
bioRxiv - Genomics 2022Quote: ... Individual libraries were then combined in 3-plex reactions for probe hybridization using oligos from the respiratory panel (Cat No: 20044311, Illumina). The Respiratory Virus Oligo Panel (RVOP ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was prepared using the manufacturers protocol (Chromium Single Cell 3’ reagent kits kit v3, 10x Genomics) and sequenced on a Novaseq 6000 instrument (Illumina). After sample processing and quality control analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... Illumina sequencing libraries were indexed with unique 5’ and 3’ barcode combinations (up to 384 cells) using the Nextera XT DNA library preparation kit (Illumina). Libraries were pooled and size-selected with 0.9X AmpPure XP beads ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA libraries were prepared using the 10X Genomics 3’mRNA-seq workflow (10X Genomics) and sequenced using a NovaSeq instrument (Illumina). Data was processed using CellRanger (10X Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were processed using the Chromium Next GEM Single Cell 3’ Reagent Kits (10x genomics) and sequenced on a NovaSeq 6000 (Illumina) at the Harvard Medical School Biopolymers Core Facility as 28 (read 1 ...
-
bioRxiv - Microbiology 2023Quote: ... 3-5 µg of each sample was treated with Ribozero® rRNA Removal Kit according to the manufacturer’s instructions (Illumina, USA ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Genomics 2023Quote: ... Micro-C libraries (at least 3 per each biological replicate) that passed QC criteria were pooled and paired-end sequenced on a NovaSeq6000 platform (Illumina) to >600 million read pairs per replicate ...
-
bioRxiv - Immunology 2023Quote: ... Single-cell RNA libraries were prepared according to the 10x Genomics Chromium Single Cell 3′ Reagent Kits v2 User Guide and sequenced (paired-end) on a HiSeq 4000 (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 3) DNA Sequencing and Genomics Laboratory (BIDGEN): Libraries were prepared using the Nextera™ DNA Flex Library Preparation Kit (Illumina) and sequenced on a NovaSeq6000 to generate 2 x 150 bp reads ...
-
bioRxiv - Genomics 2024Quote: ... 4.5 µl of sample were used to generate single cell RNA-Seq libraries by following the Illumina Bio-Rad SureCell WTA 3’ Library Prep Guide (Illumina, San Diego CA and Bio-Rad ...
-
bioRxiv - Genomics 2024Quote: ... was used for a tagmentation reaction that included 3 µL of 2X TMP buffer and 0.5 µL of Transposome (BLT; CAT # 20015880, Illumina Inc.), incubated in a thermocycler at 53 ℃ for 30 minutes with the lid set at 80 ℃ ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... RNA libraries were prepared using QuantSeq 3’-mRNA Library Prep Kit (Lexogen) and RNA-seq was performed with the NovaSeq 6000 (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lexogen) and samples were sequenced on the HiSeq4000 (Illumina) in single read mode at the Genomics Core (KU Leuven) ...
-
bioRxiv - Pathology 2024Quote: ... The cDNA libraries were prepared using a Chromium Single Cell 3’ V3 kit (10X Genomics, USA) according to the manufacturer’s instructions and then sequenced on a NovaSeq6000 (Illumina, USA). Raw sequencing reads were aligned to the mm10 (GENCODE vM23/Ensembl 98 ...
-
bioRxiv - Immunology 2021Quote: ... GEX libraries were pooled and sequenced at a depth of approximately 540,000,000 reads per sample in a single S4 flow cell and ADT libraries at a depth of approximately 79,000,000 reads per sample in a single lane of an S4 flow cell on a NovaSeq™ 6000 (Illumina, San Diego, CA; Extended Data Table 6)
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide containing the Illumina P7 adaptor sequence was ligated to the 3’ end of the single stranded LAM PCR fragments using Circligase (Epicentre/Illumina, #CL9025K). A P5 adaptor was added by PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries (1.3 nM) were chemically denatured and applied to an Illumina NovaSeq flow cell using the NovaSeq XP chemistry workflow (Illumina-20021664). Following transfer of the flowcell to an Illumina NovaSeq instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... The cell solutions were immediately transferred to ice and transported to the Wellcome Trust Centre for Human Genetics (WTCHG) for scRNAseq via 10x genomics chromium (10x genomics, US) (Single Cell 3’ v3) and Illumina hiseq 4000 (Illumina, US). This approach achieved 66-72K mean reads per cell and a sequencing depth of 53-55% per cell before filtering.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was extracted and sequence reads (100 bp paired-end) were generated with Illumina TruSeq high output version 3 chemistry on a HiSeq 2500 (Illumina, Inc.) at NRC-Plant Biotechnology Institute (NRC-PBI) ...
-
bioRxiv - Cancer Biology 2020Quote: ... TN5 tagmentation and library amplification realized 3’end fragments by Nextera XT DNA Sample Preparation Kit (Illumina, Cat#FC-131-1024) according to the manufacturer’s instructions while P5_TSO and Nextera_N7xx took the place of the custom primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... 500 ng of total RNA were used as input for QuantSeq (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina; Lexogen) following the autoQuantSeq automated workflow ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were processed according to the standard 10x Chromium 3’ workflow and pooled before sequencing over two lanes (Illumina HiSeq 4000).
-
bioRxiv - Cancer Biology 2019Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters from TruSeq™ Stranded Total RNA Sample Preparation Kit with Ribo-Zero Gold (Illumina) were ligated.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...