Labshake search
Citations for Illumina :
251 - 300 of 991 citations for 8 DECYLOXYPYRENE 1 3 6 TRISULFONIC ACID TRISODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Microbiology 2023Quote: For array-based gene expression analysis: Analysis of gene expression was performed using the MouseWG-6 v2.0 array (Illumina), following quality testing of mRNA using an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... scRNA-seq libraries were pooled at equimolar concentration and sequenced to saturation (median 6 reads/UMI) on an Illumina NextSeq 500 sequencer and using high-output 75 cycles v2.5 kits (Illumina), obtaining 483M reads in total ...
-
bioRxiv - Neuroscience 2019Quote: ... When samples showed RNA Integrity Number (RIN) > 8 they were collected and RNA was further processed according to manufacturer’s protocol (Illumina, Catalog # RS-122-9004DOC) followed by sequencing by Illumina HiSeq 4000 (50 base pair single read).
-
bioRxiv - Microbiology 2021Quote: ... and Bakt_805R (GACTACGVGGGTATCTAATCC)38 PCR primer pair with an individual 8 bp barcode adapter (based on the NEB Multiplex Oligos for Illumina, New England Biolabs) attached to the forward primer and the reverse primer ...
-
bioRxiv - Microbiology 2022Quote: ... with up to 100 ng DNA input following the manufacturer’s protocol using internal single-index 8 bp barcodes with TruSeq®adapters (Illumina, San Diego, CA) or the Nextera®DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Purified libraries were sequenced on Illumina MiSeq platform (reagent kits: v2 300-cycles, paired-end mode) at 8 pM loading concentration with 25% PhiX spike-in (Illumina FC-110-3001). Custom sequencing primers were spiked into reagent cartridge (well 12 ...
-
bioRxiv - Microbiology 2023Quote: ... RNA samples with RQNs ranging from 8 to 10 were used for RNA library preparation with the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). Briefly ...
-
bioRxiv - Genomics 2023Quote: ... The tagmentation and library preparation was performed with the Nextera DNA Library Preparation Kit with 8 cycles of PCR amplification (Illumina #FC-121-1030).
-
bioRxiv - Physiology 2023Quote: ... RNA samples with RQNs ranging from 8 to 10 were used for RNA library preparation with the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA samples with RQNs ranging from 8 to 10 were used for RNA library preparation with the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). Briefly ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and were then sent to the Swedish National Genomics Infrastructure’s SNP & SEQ platform in Uppsala for Illumina HiSeq 2500 sequencing (8 lanes; 126 bp Paired-End sequencing; Illumina, San Diego, CA, USA).
-
bioRxiv - Genomics 2019Quote: ... RNAseq libraries were pooled and sequenced via single end 50 bp reads on a HiSeq 2500 (4 libraries per lane) or HiSeq 4000 (6 libraries per lane)(Illumina).
-
Blind exploration of the unreferenced transcriptome reveals novel RNAs for prostate cancer diagnosisbioRxiv - Genomics 2019Quote: ... above 6 were depleted for ribosomal RNA and converted into cDNA library using a TruSeq Stranded Total Library Preparation kit (Illumina). cDNA libraries were normalized using an Illumina Duplex-specific Nuclease (DSN ...
-
bioRxiv - Genomics 2019Quote: ... The pooled library contained three samples at 6 pM with 9% PhiX and was sequenced with a 50-cycle single-end MiSeq reagent kit (Illumina). The sequencing reads were aligned to the reference genome (NC 000913.3 ...
-
bioRxiv - Microbiology 2020Quote: ... One microgram of gDNA with a DNA integrity number (DIN) of <=6 was used for library preparation using the TruSeq PCR-free library preparation kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and mate-pair libraries of 3 kb and 6 kb insert sizes were prepared using the Nextera Mate Pair Sample Preparation Kit (cat. No. FC-132-1001, Illumina). We then assessed library quality using the HS DNA Kit (Agilent ...
-
bioRxiv - Genomics 2019Quote: ... Sequencing libraries of A and B containing 6 bp indexes were prepared using the TruSeq RNA sample prep kit (Illumina) following a modification of the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... DNA-Seq libraries were prepared using Nextera XT library preparation kit with 700 pg DNA input per sample and 6:30 min tagmentation at 55 °C and barcoded using Nextera XT indexes (Illumina). RNA-Seq libraries were prepared using KAPA RNA HyperPrep kit (Roche ...
-
bioRxiv - Immunology 2023Quote: ... all indexed libraries were pooled with 6% PhiX spike-in DNA and sequenced using a MiSeq Reagent Nano Kit v2 (500 cycles) (Illumina) at the Fralin Genomics Sequencing Center.
-
bioRxiv - Cell Biology 2022Quote: ... Multiplexed libraries for the 1.5 h samples were generated using the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit and for the 6 h samples using TruSeqHT Stranded Total RNA Library Prep protocol (Illumina).
-
bioRxiv - Plant Biology 2023Quote: Prepared libraries were pooled and diluted to 6 pM for TruSeq Paired End v4 DNA clustering on one single flow cell lane using a cBot device (Illumina). Final sequencing was carried out on an Illumina HiSeq 2500 platform using 126 ...
-
bioRxiv - Bioengineering 2023Quote: ... pair-end single index sequencing parameters were adjusted to 101/6/0/86 (as opposed to 74/6/0/86) to effectively utilize the capabilities of the NovaSeq 200 cycle reagent kit (Illumina). To demultiplex each sample and to generate the matrix of transcript counts in each cell ...
-
bioRxiv - Cancer Biology 2024Quote: ... The paired-end reads of 150 bp were generated in an S4 flowcell with v1.5 sequencing chemistry on a NovaSeq-6 000 platform (Illumina Inc.). Read quality was checked by FastQC tool v0.11.9 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).
-
bioRxiv - Genomics 2020Quote: ... and 8 to 11 kb were generated using the gel selection-based protocol of the Nextera mate pair kit (Illumina, San Diego, CA, USA) and a 0.6% agarose gel in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... with up to 100 ng DNA input following the manufacturers protocol using internal dual-index 8 bp barcodes with Nextera® adapters (Illumina, San Diego, CA). All libraries were quantified with TapeStation®(Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... All samples showed a high RNA quality (RNQ>8) and were sequenced using an Illumina® HiSeq 3000 sequencer (Illumina, San Diego, CA, USA). Reads were mapped to the Sscrofa11.1 assembly of the Swine Genome Sequencing Consortium (SGSC ...
-
bioRxiv - Physiology 2023Quote: ... A second round of PCR was performed with 50 ng DNA input for 8 cycles to attach Nextera XT indices and adapters using the Illumina Nextera XT Index Kit (Illumina, Catalog #FC-131-200x) and Phusion HF PCR master mix (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... The INA-6 cells were sequenced (18 million reads per sample) using the TruSeq Stranded mRNA library preparation kit from Illumina (#20020595) followed by 75bp single read sequencing on the Illumina Hiseq 4000 next machine ...
-
bioRxiv - Neuroscience 2021Quote: ... and 80 million reads for each of the 24 samples of 3xTg-AD and C57BL/6×129/Sv mice in a fraction of a sequencing lane on HiSeq2000 (Illumina, Inc) following the manufacturer’s protocol ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... RNA fragmentation was performed at 94°C for 6 minutes and 10 PCR cycles were used during library amplification with TruSeq single-index adapters (Illumina, #20020492). Final library concentrations were quantified with both Qubit fluorometric quantification (DNA dsDNA HS kit ...
-
bioRxiv - Neuroscience 2023Quote: ... We then randomly selected 2–3 scrambled-injected and 5–6 F0 knockout larvae for sequencing of the targeted loci (see Preparation of samples for Illumina MiSeq).
-
bioRxiv - Cell Biology 2021Quote: ... and 3 cycles of PCR for incorporation of unique dual indices (NEBNext multiplex oligos for Illumina) to the final libraries ...
-
bioRxiv - Cancer Biology 2021Quote: ... Both libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD from Illumina, following the standard protocol ...
-
Three Distinct Transcriptional Profiles of Monocytes Associate with Disease Activity in SSc PatientsbioRxiv - Genomics 2022Quote: ... Both full-length and 3’ RNA- seq libraries were sequenced on a NextSeq 500 instrument (Illumina) with 5-10 x 106 aligned reads per sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina) to perform the sequencing.
-
bioRxiv - Cell Biology 2019Quote: ... COX4I2 and 3’ end of ID1 (green fluorescently labelled BAC (RP5-857M17) provided by BlueGnome (Illumina)) and the 20q telomere probe the TelVysion 20q Spectrum Orange (Cat ...
-
bioRxiv - Genomics 2019Quote: ... The sequencing was conducted on the MiSeq reagent v.3 600 cycles (Illumina, San Diego, CA). The four genomes were assembled using ngs_mapper v1.5 ...
-
bioRxiv - Genomics 2021Quote: ... and dual-indexed 3’ digital gene expression (DGE) sequencing libraries were prepared using Nextera XT (Illumina). Libraries were sequenced on a NovaseqS4 or NovaseqS2 with a paired end read structure (R1 ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Genetics 2020Quote: ... 3 groups in total) and constructed using the Illumina TruSeq Stranded Small RNA Sequencing kit (Illumina) according to the manufacturer’s instructions ...