Labshake search
Citations for Illumina :
1 - 50 of 2597 citations for 8 Chloro 1 2 3 4 tetrahydro 1 4 methylphenyl sulfonyl 5H 1 benzazepin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: ... The purified PCR products were then processed and sequenced using the NextSeq 75 – High Output (82 cycles in read 1, 8 cycles in index 1, and 8 cycles in index 2 SE reads) (Illumina). The sequencing data was analyzed using the Model-Based Analysis of Genome-wide CRISPR/Cas9 Knockout (MAGeCK ...
-
bioRxiv - Molecular Biology 2022Quote: ... by adding 4 μl of 1× CircLigase II Buffer (Epicentre/Illumina), 2 μl of 50mM of MnCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... puteoserpentis (499ROV/1-4) specimens using short-read (Illumina HiSeq 3000) and long-read (PacBio ...
-
bioRxiv - Genomics 2019Quote: ... 500bp and 800bp) and long insert mate-pair reads (4-6Kb, 8-10Kb and 1-20Kb) were sequenced using HiSeq 2500 (Illumina Inc., USA) at SciGenom Labs ...
-
bioRxiv - Genomics 2023Quote: ... coverage and eight additional female genomes (4 Asian and 4 African) at ~30× (1 lane of Illumina Hiseq X Ten) coverage using 10x Linked-Reads at HudsonAlpha Institute of Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were sequenced Paired-End 151 bases (in addition: 8 bases for index 1 and 8 bases for index 2) setup using the NovaSeq 6000 instrument (Illumina) and the S1 Flow-Cell loaded at a final concentration in Flow-Lane loaded of 340pM and including 1% PhiX.
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were sequenced Paired-End 51 bases (in addition: 8 bases for index 1 and 8 bases for index 2) setup using the NovaSeq 6000 instrument (Illumina). SP Flow-Cell was loaded at a final concentration in Flow-Lane loaded of 400pM and including 1% PhiX ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were sequenced Single-reads 76 bases (in addition: 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 (Illumina) using the NextSeq 500 High Output Kit 75-cycles (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... UK). Libraries were prepared from 8 samples (4× T. brucei, 4× T. congolense) using the TruSeq Stranded mRNA kit (Illumina) and 2 × 75 bp paired-end sequencing was carried out using a HiSeq 4000 system (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... 4 μl of 1 ng amplicon DNA was combined with a mix containing 1 μl of Amplicon Tagment Mix (Illumina, FC- 131-1096) and 5 μl of Tagment DNA Buffer (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... 8 bp Index 1 on a NextSeq 550 sequencer (Illumina). Primers used for sample indexing PCR are listed in Extended Data Table 5.
-
bioRxiv - Immunology 2022Quote: ... Index read 1:8 cycles or on a HiSeq X (Illumina), using a 150 cycle flowcell with the read configuration ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 bases for index 1 and 8 bases for index 2) using the NextSeq 500 High Output Kit 75-cycles (#FC-404-1005, Illumina) loaded at 1.8pM and including 1 % PhiX ...
-
bioRxiv - Genomics 2023Quote: ... indexed using IDT for Illumina Nextera UD indexes Sets 1–4 (384 Indexes, Cat no: 20043137, Illumina, USA) and products were amplified ...
-
bioRxiv - Plant Biology 2020Quote: ... A total of 56 samples (Appendix 1) were sequenced together on one lane of 1×75bp NextSeq500 High Output (Illumina).
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Genomics 2023Quote: ... All libraries were pooled and subjected to paired-end 75 bp sequencing (paired- end 76 nt reads with the first 1 nt of Read 1 and the last 1 nt of Read 2 trimmed) using the NextSeq500 system (Illumina, CA, USA). For each library ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Genomics 2022Quote: ... 5 μl of Index primer (both provided in NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2), and 25 μl NEBNext Ultra II Q5 Master Mix (PCR cycling conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... pre-treatment and post-treatment/acquired resistant biopsies were obtained from patients receiving various immune checkpoint inhibitor treatments (PD-L1, PD-1, CTLA-4 targeted therapies) for RNA-seq analysis (Illumina HiSeq2500) from formalin fix paraffin embedded samples ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Cell Biology 2024Quote: ... 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 using the NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Flow lanes were loaded at 1.8pM ...
-
bioRxiv - Cell Biology 2024Quote: ... 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 using the NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Flow lanes were loaded at 1.8pM ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Genomics 2020Quote: ... 64 RNA-Seq libraries (4 time points x 4 tissues x 4 biological replicates) were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on Illumina Nova-Seq 6000 sequencing platform at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Genomics 2019Quote: ... The resulting libraries always contain dual-indexes in the standard indexing positions and may optionally contain additional internal indexes (Figs. 1–3; Table 1; Illumina, 2018b). These indexes are recovered through the four standard separate sequencing reactions generated by Illumina instruments when doing paired-end sequencing (Fig ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Genomics 2021Quote: ... Lab 1 and 2 sequenced DNA with a NovaSeq 6000 (Illumina,
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCT TG, Illumina TruSeq Adapter Read 2 ...
-
bioRxiv - Neuroscience 2022Quote: ... using single end 75bp for Read 1 and 8bp for index 1 and 8bp for Index 2 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample.
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 4) DC3000 + B (Illumina only), 5 ...
-
bioRxiv - Immunology 2021Quote: ... Group 4 (French European, Illumina), Group 5 (North American ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Cancer Biology 2020Quote: ... with MiSeq Reagent Kit V3 (150 cycle) (Illumina, MS-1-2-3001). The sequencing data was de-multiplexed and trimmed to contain only the sgRNA sequence cassettes ...
-
bioRxiv - Neuroscience 2019Quote: ... Index 2: 8 cycles) across 2 runs on a NextSeq 500 (Illumina) with an average read depth across biological replicates of 8,815 reads per cell.
-
bioRxiv - Genomics 2021Quote: ... We used one of the cohorts for our main analyses (AEMS450K1, Athero-Express Methylation Study Illumina 450K 1) and the other smaller cohort for replicating the effect size of methylation sex differences (AEMS450K2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Pools of 4 or 5 multiplexed libraries were loaded per lane of a HiSeq 2000 sequencer (Illumina) at 8 pM and single-end sequenced using the 100 bp protocol.
-
bioRxiv - Genomics 2021Quote: ... Nuclear isolation of 5×10^4 cells was followed by treatment with Nextera Tn5 enzyme (Illumina, 20034198) for 45 minutes at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... RNA from cultures grown on PM-4-HBA and PM-syringic acid was processed and sequenced at the University of Wisconsin-Madison Biotechnology Center (Illumina HiSeq2500, 1×100 bp, single end). RNA from cultures grown on PM-succinate was processed and sequenced at the U.S ...