Labshake search
Citations for Illumina :
351 - 400 of 1953 citations for 7H Benzocyclohepten 7 one 2 amino 5 6 8 9 tetrahydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Library pool was quantified on Bioanalyzer and with qPCR and sequenced using one NextSeq 500/550 High Output Kit v2.5 (Illumina, 20024907) on Illumina NextSeq500 using these parameters ...
-
bioRxiv - Genomics 2020Quote: ... One of the DNA preps inferred to have HMW DNA was used to prepare a linked reads Chromium library (10x genomics) and was sequenced on one lane of HiSeqX (Illumina).
-
bioRxiv - Neuroscience 2019Quote: ... #PN-120237) with 18 cDNA pre-amplification cycles and sequencing on one high-output lane of the NextSeq 500 (Illumina).
-
bioRxiv - Neuroscience 2019Quote: ... these had been selected using BARCOSEL26 to allow pooling and sequencing of all samples in one pool run on three separate runs on a MiSeq (Illumina; v3 600 cycle kit ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... at least one microgram of each DNA or RNA (depleted of ribosomal RNA using Illumina Ribo-Zero rRNA Removal Kit) sample was sequenced commercially using the Illumina HiSeq2500 platform with 150 or 250-base paired-end libraries (Novogene Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... The final pool was loaded in one lane of an S2 flow cell using the NovaSeq XP protocol (Illumina Inc.) (Figure S3 ...
-
bioRxiv - Bioengineering 2022Quote: ... Barcoded RNA-seq libraries were sequenced using a NovaSeq 6000 on one SP lane with single-reads 100 nt in length (Illumina). FastQ read files were generated and demultiplexed using the bcl2fastq v2.20 Conversion Software (Illumina) ...
-
bioRxiv - Neuroscience 2020Quote: ... One and a half picomoles of pooled libraries were sequenced in the 75bp single-end configuration on a NextSeeq500 (Illumina) using a NextSeq 500/550 High Output Kit ...
-
bioRxiv - Genomics 2022Quote: ... then single-end sequenced (1 x 100 bp) on one lane using TrueSeq PE150 kit (Illumina, Inc., San Diego, CA) on an Illumina HiSeq 2000 instrument ...
-
bioRxiv - Clinical Trials 2019Quote: ... Three hundred eighty-four purified samples were pooled into one library and then subjected to paired-end sequencing using Illumina MiSeq Nano 300 V2 cycle kits (Illumina) at a concentration of 12 pM.
-
bioRxiv - Immunology 2020Quote: ... 384 purified samples were pooled into one library and then subjected to paired-end sequencing using Illumina MiSeq Nano 300 V2 cycle kits (Illumina) at a concentration of 12 pM.
-
bioRxiv - Molecular Biology 2019Quote: ... DNA isolated from subway air samples were subjected to SMS (150 bp paired-end) multiplexed on one lane (∼80-130M paired-end reads) on a HiSeq 3000 (Illumina). Library preparation was done with the ThruPLEX DNA-Seq kit (Takara Bio ...
-
bioRxiv - Plant Biology 2020Quote: ... A total of 56 samples (Appendix 1) were sequenced together on one lane of 1×75bp NextSeq500 High Output (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA libraries were prepared as outlined by the Single Cell 3′ Reagent kit v3 user guide and each of the three resulting libraries were sequenced on one lane each of a HiSeq 2500 (Illumina) in rapid mode.
-
bioRxiv - Genomics 2020Quote: ... DNA pools and from one single individual of each sex were constructed using the Genomic DNA Sample Preparation Kit (Illumina) according to manufacturer’s instructions and sequenced on the Illumina HiSeq2000 platform (Illumina ...
-
bioRxiv - Immunology 2020Quote: ... The two enriched libraries from direct flow cytometric cell sorting were combined into one library pool and sequenced on a NovaSeq sequencer (Illumina) with a NovaSeq 6000 S1 Reagent Kit (300 cycles ...
-
bioRxiv - Immunology 2020Quote: ... The six enriched libraries from bulk expansion were combined into one library pool and sequenced on a NovaSeq sequencer with a NovaSeq 6000 S4 Reagent Kit (300 cycles (Illumina). All enriched V(D)J libraries were targeted for sequencing depth of at least 5,000 raw read pairs per cell ...
-
bioRxiv - Immunology 2020Quote: ... One ng of pre-amplified cDNA was used to generate barcoded Illumina sequencing libraries (Nextera XT library preparation kit - Illumina) in 8 μl reaction volume ...
-
bioRxiv - Microbiology 2022Quote: ... All RNA samples were shipped on dry ice to the DNA Technologies Core at the University of California Davis for library construction with poly-A enrichment and sequencing on one lane of the NovaSeq 6000 platform (Illumina) with S4 type flow cell (150 bp PE).
-
bioRxiv - Molecular Biology 2022Quote: The RNA from the lysates and elutions of three HOW(S)-HA pull-downs and one nanos-GAL4 parental control pull-down was prepared using the Ribo-Zero rRNA Removal Kit (Illumina) followed by the TruSeq Stranded Total RNA Library Prep (Illumina) ...
-
bioRxiv - Pathology 2023Quote: ... One hundred nanograms of DNA obtained from tails were used for library preparation with a TruSeq DNA Nano kit (Illumina). Libraries were sequenced on the NovaSeq 6000 platform (2 x 150 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... was used to prepare a whole-transcriptome sequencing library and sequenced on one lane of a NovaSeq 6000 SP (Illumina) machine.
-
bioRxiv - Genetics 2023Quote: ... and the pool was sequenced on one lane of the Illumina HiSeq 4000 sequencer with a 75 bp Paired-End SBS chemistry (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... The uniquely barcoded libraries were multiplexed onto one lane and 100-bp paired-end deep sequencing was carried out at the HiSeq 4000 (Illumina) generating ∼20 million reads per sample.
-
bioRxiv - Molecular Biology 2023Quote: ... we used one lane of a NovaSeq 6000 SP Reagent Kit v1.5 (100 cycles) (Illumina, San Diego, CA, USA, 20028401) (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: ... The final clone was confirmed to have two copies or the DNMT3AR882H allele and one copy of the DNMT3AWT allele by Illumina amplicon sequencing (Figure S1).
-
bioRxiv - Genomics 2023Quote: ... Each pool of libraries was sequenced independently by method on one lane of a NovaSeq6000 S Prime (SP) flowcell (Illumina), for three SP lanes in total ...
-
bioRxiv - Genomics 2023Quote: ... The resulting sequencing libraries were sequenced using the MiSeq system (Illumina v.2 kit, 2 × 150 bp).
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Immunology 2019Quote: ... The indexed samples were multiplexed per 4 or 6 and sequenced on a HiSeq2500 sequencer (Illumina) to produce single-ends 65 bases reads ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.75 nM libraries were pooled in 6-plex and sequenced on a HiSeq X Ten (Illumina) to produce paired-end 150 bp reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6 pM of DNA library spiked with 1% PhiX viral DNA was clustered on cBot (Illumina) and then sequenced on a HiScanSQ module (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Microbiology 2023Quote: ... and sequenced at Novogene on 1 HiSeq PE 150 lane (6 bp, i7 single index, Illumina). The output of the lane was 375 million reads.
-
bioRxiv - Systems Biology 2021Quote: ... Libraries of extracted RNAs whose A260/A280 >1.8 and RIN >8 were built using the Illumina TruSeqTM RNA sample preparation kit (RS-122-2001, Illumina) and sequenced by an illumina HiSeq 2000 system with paired-end 100-bp reads ...
-
bioRxiv - Cell Biology 2019Quote: ... 100 to 200ng of high-quality total RNA sample (RIN >8) was processed using TruSeq Stranded mRNA kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 µL was amplified and hybridized on the Infinium MehtylationEPIC BeadChip (EPIC array; Illumina, Inc., San Diego, CA, U.S.A.). All samples were randomized in a balanced manner for sex and Braak stage ...
-
bioRxiv - Immunology 2022Quote: ... 5,000-50.000 cells per experiment were centrifuged 5 minutes at 8°C, and resuspended in 25 µl transposase mixture (12.5 µl Tagmentation DNA buffer, 1 µl Tn5 transposase (Illumina), 10.75 µl nuclease-free water ...
-
bioRxiv - Genomics 2023Quote: ... 8 μl of modified DNA was subjected to methylation analysis on the Illumina Infinium MethylationEPIC BeadChip (Illumina, CA, USA) at UCL Genomics according to the manufacturer’s standard protocol.
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... corresponding to either the Australian or American samples were pooled and run on 7 lanes of the Illumina NextSeq 500 sequencer (Illumina, San Diego, USA) in 75bp paired-end reads mode.
-
bioRxiv - Neuroscience 2019Quote: ... using 2 × 75bp paired-end reads and 2 × 8bp index reads with a 200 cycle kit (Illumina, 20012861). Samples were sequenced at an average of 1.5M reads per cell.
-
bioRxiv - Neuroscience 2019Quote: ... using 2 × 75bp paired-end reads and 2 × 8bp index reads with a 200 cycle kit (Illumina, 20012861). Samples were sequenced at an average of 1.5M reads per cell.
-
bioRxiv - Plant Biology 2019Quote: ... The Hi-C libraries were sent to the Australian Genome Research Facility (Melbourne, Australia) for sequencing using one lane of 100 bp PE sequencing using a HiSeq2000 (Illumina Inc.).
-
bioRxiv - Plant Biology 2021Quote: One microgram of total RNA was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Prep Kit (Illumina Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... a total of 2.58 × 108 assembled paired-end reads was obtained as two 33 Gb FastQ files (one file per Illumina-sequence lane). The sequence quality was evaluated by means of the FastQc software (Andrews ...