Labshake search
Citations for Illumina :
151 - 200 of 1953 citations for 7H Benzocyclohepten 7 one 2 amino 5 6 8 9 tetrahydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Genomics 2021Quote: ... and four mate-pair sequencing libraries (insert sizes of 2, 5, 10, and 15 kb) in accordance with manufacturer protocols (Illumina, San Diego, CA, USA). Libraries were then sequenced using a HiSeq2000 instrument (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... and diluted to 5 pM prior to sequencing on an Illumina MiSeq platform with a 2 × 250 bp paired-end protocol (Illumina, San Diego, CA, USA). Sequencing reads were deposited in the European Nucleotide Archive (ENA ...
-
bioRxiv - Genetics 2020Quote: ... and the libraries were sequenced in pools of 6 (Illumina HiSeq2500 high output flow-cell ...
-
bioRxiv - Genomics 2019Quote: ... The library was sequenced on one lane of a rapid v2 flow cell (Illumina) in paired end 2*250nt mode ...
-
bioRxiv - Microbiology 2019Quote: We sequenced the pooled libraries in one lane of the HiSeq 4000 (Illumina, www.illumina.com) with 150 PE chemistry.
-
bioRxiv - Immunology 2021Quote: ... One pooled library containing 26 samples were sequenced on a NextSeq 500 sequencer (Illumina) using paired-end 38-base reads ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... rotundus assembly with at least one shared homozygous (based on aligned Illumina sequencing reads) inactivating mutation ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... in a fraction of one sequencing lane of an HiSeq2000 flowcell v3 (Illumina Inc.) according to standard Illumina operation procedures at Centro Nacional de Análisis Genómico (CNAG).
-
bioRxiv - Molecular Biology 2020Quote: ... One μg of total RNA was reverse transcribed with the partial P7 adapter (Illumina_4N_21T) and dNTPs with the addition of spiked-in azido-nucleotides (AzVTPs ...
-
bioRxiv - Genomics 2021Quote: ... All libraries were sequenced in one sequencing run on NextSeq 500 high-output (Illumina) with 85 bp single-end reads ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... One library was prepared for each individual using the TruSeq Stranded mRNA protocol (Illumina) and cDNA was sequenced on an Illumina NovaSeq 6000 to generate an average of 87 million 150 bp paired-end reads per library (Table S1) ...
-
bioRxiv - Genomics 2020Quote: ... The resulting libraries were sequenced with one sample per lane using the NextSeq500 (Illumina; high-output mode ...
-
bioRxiv - Immunology 2021Quote: ... The libraries were multiplexed and sequenced using one flow cell on Novaseq 6000 (Illumina) as 50bp paired-end reads ...
-
bioRxiv - Genomics 2021Quote: ... The pooled final library was sequenced on one to four lanes of HiSeq2000 (Illumina) with 68 base (Y ...
-
bioRxiv - Cancer Biology 2023Quote: ... One barcoded library was prepared per plate using TD buffer and TDE1 enzyme (Illumina) for tagmentation and KAPA HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Genomics 2023Quote: ... cycle one begins with incorporation of the first nucleotide in Incorporation Mix (Illumina MiSeq), followed by incubation with shaking at 60°C for 3 min ...
-
bioRxiv - Plant Biology 2023Quote: ... one microgram of crosslinked enriched chloroplasts was resuspended in 1X Tn5 reaction buffer (Illumina) and assayed according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... and run in one lane on a flow cell of NovaSeq 6000 SP (Illumina).
-
bioRxiv - Microbiology 2019Quote: ... 2x 8 nt dual indexed adapters from TruSeq RNA CD index kit (Illumina) were added to the libraries for multiplexing ...
-
bioRxiv - Systems Biology 2023Quote: ... and biotinylated as described 8 using HumanHT-12 v4 Expression BeadChips (Illumina, Inc.). Gene expression data were extracted and log2-transformed using GenomeStudio software (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... 8 µL of i7 primer (NEBNext Multiplex Oligos for Illumina (Dual Index primers); NEB #E7600S ...
-
bioRxiv - Microbiology 2019Quote: Two overlapping IN-PCR regions corresponding to the 288 amino acids of HIV-1 IN were sequenced with the MiSeq NGS platform (Illumina). The amplicons were purified with Agencourt AMPure XP (Beckman Coulter ...
-
bioRxiv - Genetics 2023Quote: ... and the libraries were subjected to 1 × 7 bp high-throughput sequencing by NextSeq 500 (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Genomics 2020Quote: ... sequencing reads were mapped to reference viral genome sequence and consensus sequence for each sample was built using Dragen RNA pathogen detection software (version 9) in BaseSpace (Illumina Inc, USA). For amplified whole-genome sequencing ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNAs from WT and e2fabc at 9 DAG were used for construction of cDNA libraries using the TruSeq RNA Library Preparation Kit v2 (Illumina, United States) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Evolutionary Biology 2023Quote: ... 6-digit index primers (Illumina RNA PCR Index Primers RPI1-RPI28) were used instead of 10-digit index primers suggested by the LM-Seq protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index i7 (6 pb barcode) was read with primer HP8 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Microbiology 2019Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Microbiology 2021Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Cell Biology 2022Quote: ... version 2 (Illumina) using 10 PCR cycles ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Libraries were sequenced on one lane of a HiSeq4000 (PE 150; Illumina San Diego, California).
-
bioRxiv - Genomics 2019Quote: ... four Illumina libraries were prepared and sequenced on a HiSeq2000: one paired-end library (Illumina TruSeq DNA PCR-free LT Sample Prep kit #15036187 ...
-
bioRxiv - Neuroscience 2020Quote: ... mixed in equimolar ratios and sequenced on one flow cell of NovaSeq S Prime (Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... Sequencing was carried out on one lane of an Illumina 2500 Hiseq instrument (Illumina Inc.) using 125 cycle chemistry in paired-end (PE ...
-
bioRxiv - Biochemistry 2020Quote: ... The sample was submitted to one channel of Illumina flow cell and sequenced by Illumina Genome Analyzer (GAII ...
-
bioRxiv - Genomics 2021Quote: ... Metagenomic sequencing was performed on one SP lane of the NovaSeq 6000 sequencing system (Illumina) at the Roy J ...
-
bioRxiv - Cancer Biology 2022Quote: ... the library from patient one was sequenced with an Illumina HiSeq 4000 (Illumina, Berlin, Germany) at the DKFZ Genomics and Proteomics Core Facility in Heidelberg and all other libraries were sequenced on an Illumina NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... one nanogram of DNA was fragmented and adapter ligated using the Nextera XT kit (Illumina) and unique 8bp dual-index adapters (IDT ...
-
bioRxiv - Developmental Biology 2023Quote: ... the libraries were multiplexed into one pool and sequenced using the Illumina HiSeq2500 instrument (Illumina) at National Institute for Basic Biology in Okazaki ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and the 7 other libraries were single-end sequenced using 50 cycles on a HiSeq2500 sequencer (Illumina) at the IGBMC GenomEast Platform (Illkirch ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Genomic DNA (7 ng) from each sample was first fragmented using a partial Nextera reaction (Illumina, Inc), which also ligates short adapter sequences to the ends of the fragments ...
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp to sufficient read depth with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp to sufficient read depth with PhiX spike-in controls (7%) (Illumina San Diego, CA).