Labshake search
Citations for Illumina :
201 - 250 of 1962 citations for 6H Benzo g 1 4 diazonino 7 6 5 cd indol 6 one 10 ethenyl 1 3 4 5 7 8 10 11 12 13 decahydro 4 hydroxymethyl 8 10 13 trimethyl 7 13 bis 1 methylethyl 4S 4R* 7R* 10S* 13S* 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... Extracted RNA with RNA integrity number (RIN) ≥7 was used as input for the TruSeq Stranded mRNA HT Sample Prep Kit (Illumina) according to the manufacturer ‘s recommendations ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sequencing was performed on a HiSeq 2000 series for 2 × 100 paired end reads with a 7 nucleotide read for indexes using Cycle Sequencing v3 reagents (Illumina). All regions were covered by >200 reads.
-
bioRxiv - Cell Biology 2020Quote: ... denatured and diluted to 10 pM with pre-chilled hybridization buffer and loaded into TruSeq PE v3 flowcells on an Illumina cBot followed by indexed paired-end sequencing (101 + 7 + 101 bp) on an Illumina HiSeq 2000 using TruSeq SBS Kit v3 chemistry (Illumina). Paired de-multiplexed fastq files were generated using CASAVA software (Illumina ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... between 200 ng to 1μg of high-quality RNA (RIN > 7) samples were used for cDNA synthesis and library preparation using the TruSeq Stranded total RNA Sample Preparation kit (Illumina). The cDNA libraries were then sequenced with 2 × 150 bp reads on an Illumina HiSeq3000 instrument ...
-
bioRxiv - Cancer Biology 2021Quote: ... Barcoded libraries of ten samples (4 treated, 4 untreated and two controls) were equimolarly pooled and sequenced on MiSeq (Illumina) using MiSeq v3 150 reagent kit (MS-102-3001 ...
-
bioRxiv - Microbiology 2021Quote: ... 8) DC3000 − B (Illumina only), 9 ...
-
bioRxiv - Microbiology 2021Quote: ... 12 assemblies were done: 1) baseline (Illumina only), 2 ...
-
bioRxiv - Genomics 2019Quote: ... and 4 μL TDE1 (tagment DNA enzyme, Illumina). 0.1% SDS treatment then denatured the enzyme and 1:1 SPRI followed by elution in TE buffer was used to remove SDS ...
-
bioRxiv - Genomics 2023Quote: ... 4 washes with PR2 buffer (PR2, Illumina MiSeq), and 6 minute incubation at 60°C with shaking followed by 4 washes was performed a total of 3 times ...
-
bioRxiv - Genomics 2020Quote: ... Other libraries were sequenced on NextSeq 500 (1x 28 / 1×91 cycles plus 8 base index cycle) using the v2 150 cycle High Output kit (Illumina) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 bases for index 1 and 8 bases for index 2) using the NextSeq 500 High Output Kit 75-cycles (#FC-404-1005, Illumina) loaded at 1.8pM and including 1 % PhiX ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Cell Biology 2020Quote: ... The adapter-ligated library was completed by PCR with Illumina PE primers (8-11 cycles) and the resulting directional cDNA libraries were sequenced for 50 bases in a single-read format (Illumina HiSeq2000) and analyzed with nextpresso (Graña ...
-
bioRxiv - Molecular Biology 2020Quote: ... before combining 6 samples into one flow cell for sequencing on a HiSeq 2000 sequencer (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... A 10% spike-in of 90 pM PhiX Control v3 (Illumina, Inc.) was added to the pooled 90 pM library and 20 μl of the resulting library was run on the iSeq 100 System using paired-end 150 bp sequencing with adapter removal ...
-
bioRxiv - Plant Biology 2022Quote: ... The sequences were obtained by an Illumina X-10 instrument (Illumina, America). The raw data were compared with the B73_V4 reference genome data by HISAT2 v2.0.4 (http://daehwankimlab.github.io/hisat2/) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 µl of 10% Tween-20 and 2.5 µl of transposase (Illumina Tagment DNA enzyme 1 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... amplicon libraries were barcoded using the IDT 10 bp UDI indices (Illumina) and sequenced on an Illumina MiSeq to produce 250 bp paired-end reads ...
-
bioRxiv - Genomics 2023Quote: ... along with 10 ul of Nextera DNA Flex Dual Index adapters (Illumina: IDT for Illumina DNA/RNA UD indexes ...
-
bioRxiv - Cancer Biology 2023Quote: With the exception for Whole Transcriptome Amplification Analysis (WTA)7 (sent to Novogene and sequenced on a S4 flowcell of an Illumina Novaseq), all single-cell or bulk sequencing was prepared as ready-made libraries and sequenced either on Illumina Novaseq or Nextseq 500 instruments at the Functional Genomics Center Zurich ...
-
bioRxiv - Neuroscience 2023Quote: ... We then randomly selected 2–3 scrambled-injected and 5–6 F0 knockout larvae for sequencing of the targeted loci (see Preparation of samples for Illumina MiSeq).
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Genetics 2019Quote: ... An average of 39.7 million 2 x 75 bp paired- end reads were generated for each sample on an Illumina NextSeq 500 (Illumina, Carlsbad, CA). FastQC was used to evaluate the quality of the reads ...
-
bioRxiv - Plant Biology 2019Quote: ... The main library was spiked at 10% with the PhiX control library (Illumina). Sequencing was performed using Illumina NextSeq in the Departments of Biochemistry and Pathology at the University of Cambridge ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 µl of 2x TD Buffer (from Nextera XT DNA Prep Kit, Illumina) and 2 µl of Tn5 Transposase (from Nextera XT DNA Prep Kit ...
-
bioRxiv - Microbiology 2022Quote: ... and submitted to an additional 10 rounds of PCR with indexing primers (Illumina). The resulting libraries were pooled by volume with specimens at 100x the positive controls ...
-
bioRxiv - Genetics 2023Quote: ... Paired-end sequencing of libraries was performed on HiSeq X-10 instrument (Illumina).
-
bioRxiv - Developmental Biology 2019Quote: The BRB-seq is a technique for multiplexed RNA-seq16 which is able to provide high-quality 3’ transcriptomic data at a low cost (e.g. 10-fold lower than Illumina Truseq Stranded mRNA-seq). The data (fastq files ...
-
bioRxiv - Genomics 2019Quote: ... was isolated from 1 µg of total RNA and 6 RNA-Seq libraries were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on an Illumina HiSeq 2000 platform at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Microbiology 2023Quote: ... Multiplexing of sgRNA challenge screens in BCBL-1 was performed utilizing 6-bp indexes and sequenced on a single lane of a HiSeq4000 (Illumina) using 50bp single-end (SE ...
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nuclei were centrifuged at 500 g for 10 min and immediately resuspended in 25 µl of buffer containing 2.5 µl of Tn5 transposase (Illumina, Inc., San Diego, CA cat # 15027865) for a 30 min incubation at 37oC ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... corresponding to either the Australian or American samples were pooled and run on 7 lanes of the Illumina NextSeq 500 sequencer (Illumina, San Diego, USA) in 75bp paired-end reads mode.
-
bioRxiv - Developmental Biology 2019Quote: ... Up to 6 barcoded samples were pooled in one lane of the flow cell and sequenced by Illumina NextSeq 500 (MidOutput run) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and loaded at 4 nM into the MiSeq sequencer (Illumina) v3 chemistry kit spiked with 10% PhiX genome ...
-
bioRxiv - Immunology 2023Quote: ... or the NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Microbiology 2019Quote: ... RNA from cultures grown on PM-4-HBA and PM-syringic acid was processed and sequenced at the University of Wisconsin-Madison Biotechnology Center (Illumina HiSeq2500, 1×100 bp, single end). RNA from cultures grown on PM-succinate was processed and sequenced at the U.S ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 ng DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Developmental Biology 2021Quote: ... and sequenced using NextSeq500/550 High Output v2.5 kit (spiked with 10% PhiX; Illumina) to a minimum depth of 29 million reads per sample ...
-
bioRxiv - Cancer Biology 2020Quote: ... The pooled products with 10-20% PhiX were sequenced on HiSeq 2500 system (Illumina).
-
bioRxiv - Immunology 2022Quote: ... A final concentration of 4.5 pM denatured DNA library with 10% PhiX control (Illumina) was run on the Illumina MiSeq ...