Labshake search
Citations for Illumina :
451 - 500 of 1962 citations for 6H Benzo g 1 4 diazonino 7 6 5 cd indol 6 one 10 ethenyl 1 3 4 5 7 8 10 11 12 13 decahydro 4 hydroxymethyl 8 10 13 trimethyl 7 13 bis 1 methylethyl 4S 4R* 7R* 10S* 13S* 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... and sequenced on a total of 10 Hiseq 2500 lanes using the 125bp paired-end sequencing method (Illumina, San Diego, CA). Both reads of each sample were trimmed for adapters and low-quality bases using Trimmomatic software and aligned with reference human hg19 genome and ensemble v70 transcripts using Tophat software as stranded libraries ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Sequencing library preparation was then performed using Stranded Total RNA Prep Ligation kit with Ribo-Zero Plus for rRNA depletion and by using 10 bp IDT for Illumina indices (all from Illumina, USA). Sequencing was done on a NextSeq2000 instrument in 2×50 bp paired-end mode ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were equimolarly pooled with 10% PhiX control DNA and sequenced on an Illumina MiSeq using a MiSeq 2 × 250 v2 kit (Illumina, Inc.). Due to the number of samples ...
-
bioRxiv - Biophysics 2023Quote: ... 100-120 μl pooled-denatured 20 pM library and 10-20 μl 20 pM PhiX control library (Illumina, FC-110-3001) to provide a reasonable spot density in general ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were then indexed and PCR amplified (10 cycles) and sequenced on Illumina HiSeq 2500 sequencing platform following the manufacture’s protocols (Illumina, Hayward CA).
-
bioRxiv - Microbiology 2023Quote: ... Library preparation was performed using the Illumina DNA Prep Kit and IDT 10 bp UDI indices (Illumina, San Diego, CA, USA), hybrid whole genome sequencing was carried out on an Illumina NextSeq 2000 (2 × 151 bp reads ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were pooled and sequenced single-end for 75 cycles on one high-output flow cell of an Illumina NextSeq with 5% PhiX control (Illumina) added to provide sequence diversity ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were sequenced 2 * 50+8+16 bp on a HiSeq2500 sequencer (Illumina). RNA-seq data were processed according to Doyle et al ...
-
bioRxiv - Genomics 2023Quote: ... 8 µL of i7 primer (NEBNext Multiplex Oligos for Illumina (Dual Index primers); NEB #E7600S ...
-
bioRxiv - Genomics 2020Quote: ... denatured and diluted to 4 pM before loading onto the MiSeq flow cell (Illumina Inc., United States). According to Illumina protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Nuclei were then pelleted (1,000xg, 10min, 4°C) and transposed in 2.5µl Tn5 (Nextera Tn5 transposase, Illumina), 12.5µl TD reaction buffer and 10.5µl water for 40min at 37°C with rotation ...
-
bioRxiv - Genomics 2020Quote: ... The library was sequenced on 4 lanes of an Illumina HiSeq 1500 (Illumina Inc.; San Diego, CA), generating 450,132,548 reads which were subsequently trimmed to remove adapters and filtered for length and quality using FASTX-Toolkit v0.0.14 (available from http://hannonlab.cshl.edu/fastx_toolkit/) ...
-
bioRxiv - Genomics 2019Quote: ... After normalization the libraries were sequenced in 4-plex on HiSeq 2000 or HiSeq 2500 machines (Illumina) in paired-end 2 × 100 bp.
-
bioRxiv - Developmental Biology 2019Quote: The paired-end reads for each sample run across 4 lanes of the flow cell (20022408, Illumina) were concatenated to obtain one forward and one reverse fastq.gz files each ...
-
bioRxiv - Molecular Biology 2019Quote: ... (4) The amplified fragments were sequenced on the Illumina HiSeq™ 4000 platform (Illumina, San Diego, USA) by Gene Denovo Biotechnology Co ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were diluted to 4 nM and sequenced on a NextSeq 500 Sequencing System (Illumina, California, USA) using NextSeq 500/550 High Output Kit v2 (150 cycles ...
-
bioRxiv - Genomics 2021Quote: ... The library pool was sequenced on all 4 lanes of an NovaSeq 6000 S4 flow cell (Illumina) for 150 bp paired end reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Immunology 2023Quote: ... We observed less than 4% barcode swapping between the two barcodes (more than 96% of the Illumina sequencing reads contained correct endodomain and barcode pairs) ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Genomics 2020Quote: ... Five size-fractions were selected ranging from 470 bp to 10 kb to construct sequencing libraries following the manufacturer’s protocols (Illumina, San Diego, CA). The TruSeq DNA Sample Preparation Kit version 2 with no PCR amplification (PCR-free ...
-
bioRxiv - Neuroscience 2020Quote: ... and 40 from each of the 10 donors) were prepared with the TruSeq Stranded mRNA kit from Illumina (San Diego, CA, USA) and sequenced on a HiSeq 4000 sequencer (Illumina ...
-
bioRxiv - Developmental Biology 2022Quote: ... The library samples were then diluted to a 10 nM concentration and sequenced on an Illumina NovaSeq 6000 platform (Illumina, San Diego) for PE150 sequencing by Annoroad Gene Tech ...
-
bioRxiv - Cancer Biology 2020Quote: ... Drop-seq denatured libraries were loaded at 1.3pM final concentration and were spiked in with 10% of 1.8pM PhiX Control v3 (Illumina Cat# FC-110-3001). Sequencing specifications were as follows ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA was extracted from five biological replicates of each of the 222 and ii2 diet groups (10 samples in total) using the TruSeq Stranded mRNA-seq kit (Illumina, DA, USA). The samples were sequenced in one flowcell on the NextSeq 500 producing paired end reads of 75bp.
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Genomics 2021Quote: ... We used one of the cohorts for our main analyses (AEMS450K1, Athero-Express Methylation Study Illumina 450K 1) and the other smaller cohort for replicating the effect size of methylation sex differences (AEMS450K2 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 6-digit index primers (Illumina RNA PCR Index Primers RPI1-RPI28) were used instead of 10-digit index primers suggested by the LM-Seq protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index i7 (6 pb barcode) was read with primer HP8 (Illumina).
-
bioRxiv - Genomics 2022Quote: ... and Nextera DNA CD Indexes (Illumina) for 10 cycles of PCR ...
-
bioRxiv - Microbiology 2023Quote: ... Nextera DNA CD Indexes (Illumina, Inc.) were used for indexing during library prep ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Strand-specific library preparation (one library per sample) and paired-end (150 + 150 bp) Illumina sequencing (Illumina HiSeq 3000, 5 lanes) was then performed at the Finnish Functional Genomics Center (FFCG) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Microbiology 2019Quote: ... and the primers V3F - 5’-CCTACGGGNGGCWGCAG-3’ and V4R – 5’-GACTACHVGGGTATCTAATCC-3’ [28] with the addition of the appropriate Illumina Nextera XT overhang adapter sequences (Illumina, San Diego, CA, USA). Following purification using a magnetic bead capture kit (Ampure ...
-
bioRxiv - Systems Biology 2022Quote: ... Individual samples were hybridized to Illumina MouseRef-8 Expression BeadChips (Illumina, San Diego, CA) by Southern California Genotyping Consortium (SCGC ...
-
bioRxiv - Cell Biology 2022Quote: ... 8 plates of mRNA libraries were sequenced using the Nextseq550 high output kit (Illumina) with 35 paired-end reads according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: ➢ Distinct from currently used length 8 barcodes from common library kits (Illumina TruSeq, NEB)
-
bioRxiv - Systems Biology 2020Quote: ... i7 index 8 cycles and Read 2 56 cycles on a NextSeq500 instrument (Illumina) using High Output v2.1 chemistry ...
-
bioRxiv - Cancer Biology 2020Quote: ... ATAC-seq libraries (~8 per lane) were sequenced on a HiSeq 4000 platform (Illumina) by the University of Manchester Genomic Technologies Core Facility ...
-
bioRxiv - Biochemistry 2023Quote: ... diluted to a concentration of 4pM and an 8% denaturalized PhiX control (Illumina, USA) was added ...
-
bioRxiv - Neuroscience 2023Quote: ... Whole-genome SNP genotyping (SNP array) was conducted using Infinium OmniExpressExome-8-BeadChip (Illumina) and GenomeStudio V2.0.3 (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Amplicons were calculated for their nano-molarity and diluted to 4 nM (see Illumina 470-2016-007-B) for HTS run on MiSeq sequencer using the Illumina MiSeq Reagent Kit Version 3 (600bp pair-ended) ...
-
bioRxiv - Molecular Biology 2021Quote: ... before being diluted to approximately 4 nM for loading onto an Illumina MiSeq (Illumina, San Diego, CA, USA). An Illumina 500 cycle MiSeq Reagent Kit v2 (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and 4 samples were combined into RNA-seq runs on the Illumina MiSeq platform (Illumina, San Diego, CA).
-
bioRxiv - Genomics 2021Quote: ... The final libraries at the concentration of 4 nM were sequenced on NextSeq 500 platform (Illumina, CA, USA) using 75 bp paired-end sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μg total RNA per sample were used for the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina) to generate cDNA libraries according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... The additional 71 ASH donors were genotyped separately at 4,327,108 SNPs with the Infinium Omni5-4 v1.2 BeadChip (Illumina, California). We updated SNP identifiers based on Illumina annotation files (https://support.illumina.com/content/dam/illumina-support/documents/downloads/productfiles/humanomni5-4/v1-2/infinium-omni5-4-v1-2-a1-b144-rsids.zip ...