Labshake search
Citations for Illumina :
51 - 100 of 1411 citations for 6 methyl 5 6 7 8 tetrahydro 1 3 dioxolo 4 5 g isoquinolin 6 iumchloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were 6-plexed and sequenced with 2×100bp reads on a HiSeq-4000 (Illumina). The data were mapped using BWA ...
-
bioRxiv - Physiology 2022Quote: ... Samples were sequenced on the HiSeq 2500 (Figure 2) or NovaSeq 6000 (Figure 6; Illumina) using a 2×100 kit to a read depth >45 million reads/sample ...
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.75 nM libraries were pooled in 6-plex and sequenced on a HiSeq X Ten (Illumina) to produce paired-end 150 bp reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... before combining 6 samples into one flow cell for sequencing on a HiSeq 2000 sequencer (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Genetics 2019Quote: Genotype information was available for 21,001 NTR participants from 6 different genotyping arrays (Affymetrix 6.0 [N = 8,640], Perlegen-Affymetrix [N = 1,238], Illumina Human Quad Bead 660 [N = 1,439] ...
-
bioRxiv - Cell Biology 2023Quote: ... and 20 μM reverse P7 primers with 6-bp TruSeq indices that are automatically demultiplexed by Illumina software ...
-
bioRxiv - Developmental Biology 2022Quote: ... All 6 individual libraries were pooled in equal amount and sequenced with the HiSeq 4000 platoform (Illumina). The RNA-seq data are available under the GEO accession no ...
-
bioRxiv - Cancer Biology 2023Quote: ... Illumina sequencing libraries with 6-bp single indices were constructed from 1 μg total RNA using the TruSeq Stranded mRNA LT kit (Illumina, RS-122-2101). The resulting library was validated using the Standard Sensitivity NGS Fragment Analysis Kit (AATI ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bead-bound DNA was amplified with 6 PCR amplification cycles using PE PCR 1.0 and PE PCR 2.0 primers (Illumina). Primary samples T-ALL 2-5 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Up to 6 barcoded samples were pooled in one lane of the flow cell and sequenced by Illumina NextSeq 500 (MidOutput run) ...
-
bioRxiv - Systems Biology 2020Quote: ... Paired-end sequencing (75 cycles with a 6-cycle index read) was performed with the NextSeq 500 (Illumina) platform ...
-
bioRxiv - Cancer Biology 2021Quote: ... Micorarray transcriptional analysis was performed using the HumanWG-6 v3.0 expression BeadChip sytem (Illumina, San Diego, CA, USA) at the Wistar Genomics facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... in paired-end mode on Illumina (2×101 bp) using TrueSeq DNA exome kit (v.6) (Illumina Inc.). Paired-end reads were aligned to the human reference genome sequence GRCh38 using BWA–MEM (V0.715-r1140 ...
-
bioRxiv - Genetics 2020Quote: ... Pooled and denatured library (8 pM) containing 5% volume of PhiX (control library; Illumina) was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads ...
-
bioRxiv - Microbiology 2023Quote: For array-based gene expression analysis: Analysis of gene expression was performed using the MouseWG-6 v2.0 array (Illumina), following quality testing of mRNA using an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... scRNA-seq libraries were pooled at equimolar concentration and sequenced to saturation (median 6 reads/UMI) on an Illumina NextSeq 500 sequencer and using high-output 75 cycles v2.5 kits (Illumina), obtaining 483M reads in total ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7), with both containing 8N barcodes for multiplexing.
-
bioRxiv - Cancer Biology 2022Quote: ... All of the 3′ and 5′ flowcells were demultiplexed with bcl2fastq (Illumina). FASTQ files were processed with Cell Ranger v7.0.1 (10x Genomics) ...
-
Blind exploration of the unreferenced transcriptome reveals novel RNAs for prostate cancer diagnosisbioRxiv - Genomics 2019Quote: ... above 6 were depleted for ribosomal RNA and converted into cDNA library using a TruSeq Stranded Total Library Preparation kit (Illumina). cDNA libraries were normalized using an Illumina Duplex-specific Nuclease (DSN ...
-
bioRxiv - Genomics 2019Quote: ... The pooled library contained three samples at 6 pM with 9% PhiX and was sequenced with a 50-cycle single-end MiSeq reagent kit (Illumina). The sequencing reads were aligned to the reference genome (NC 000913.3 ...
-
bioRxiv - Microbiology 2020Quote: ... One microgram of gDNA with a DNA integrity number (DIN) of <=6 was used for library preparation using the TruSeq PCR-free library preparation kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and mate-pair libraries of 3 kb and 6 kb insert sizes were prepared using the Nextera Mate Pair Sample Preparation Kit (cat. No. FC-132-1001, Illumina). We then assessed library quality using the HS DNA Kit (Agilent ...
-
bioRxiv - Genomics 2019Quote: ... Sequencing libraries of A and B containing 6 bp indexes were prepared using the TruSeq RNA sample prep kit (Illumina) following a modification of the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... DNA-Seq libraries were prepared using Nextera XT library preparation kit with 700 pg DNA input per sample and 6:30 min tagmentation at 55 °C and barcoded using Nextera XT indexes (Illumina). RNA-Seq libraries were prepared using KAPA RNA HyperPrep kit (Roche ...
-
bioRxiv - Immunology 2023Quote: ... all indexed libraries were pooled with 6% PhiX spike-in DNA and sequenced using a MiSeq Reagent Nano Kit v2 (500 cycles) (Illumina) at the Fralin Genomics Sequencing Center.
-
bioRxiv - Cell Biology 2022Quote: ... Multiplexed libraries for the 1.5 h samples were generated using the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit and for the 6 h samples using TruSeqHT Stranded Total RNA Library Prep protocol (Illumina).
-
bioRxiv - Plant Biology 2023Quote: Prepared libraries were pooled and diluted to 6 pM for TruSeq Paired End v4 DNA clustering on one single flow cell lane using a cBot device (Illumina). Final sequencing was carried out on an Illumina HiSeq 2500 platform using 126 ...
-
bioRxiv - Bioengineering 2023Quote: ... pair-end single index sequencing parameters were adjusted to 101/6/0/86 (as opposed to 74/6/0/86) to effectively utilize the capabilities of the NovaSeq 200 cycle reagent kit (Illumina). To demultiplex each sample and to generate the matrix of transcript counts in each cell ...
-
bioRxiv - Cancer Biology 2024Quote: ... The paired-end reads of 150 bp were generated in an S4 flowcell with v1.5 sequencing chemistry on a NovaSeq-6 000 platform (Illumina Inc.). Read quality was checked by FastQC tool v0.11.9 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The INA-6 cells were sequenced (18 million reads per sample) using the TruSeq Stranded mRNA library preparation kit from Illumina (#20020595) followed by 75bp single read sequencing on the Illumina Hiseq 4000 next machine ...
-
bioRxiv - Neuroscience 2021Quote: ... and 80 million reads for each of the 24 samples of 3xTg-AD and C57BL/6×129/Sv mice in a fraction of a sequencing lane on HiSeq2000 (Illumina, Inc) following the manufacturer’s protocol ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... RNA fragmentation was performed at 94°C for 6 minutes and 10 PCR cycles were used during library amplification with TruSeq single-index adapters (Illumina, #20020492). Final library concentrations were quantified with both Qubit fluorometric quantification (DNA dsDNA HS kit ...
-
bioRxiv - Microbiology 2021Quote: ... The library was diluted to a final concentration of 7 pM and 5% of PhiX DNA (Illumina, USA) was added ...
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Microbiology 2021Quote: ... The library was loaded at 6 pM and sequenced using the Miseq Reagent Kit v3 (600-cycle) (Illumina; catalog no., MS-102-3003).
-
bioRxiv - Plant Biology 2020Quote: ... Genomic DNA from infected barley leaves at 6 days post-inoculation (dpi) was isolated by using the MasterPure™ Complete DNA&RNA purification Kit (Epicentre®, Illumina®) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and 800 bp) and four mate-pair libraries (2, 6, 10, and 20 Kb) following the standard protocols provided by Illumina (San Diego, USA). Subsequently ...
-
bioRxiv - Physiology 2020Quote: ... was hybridized overnight at 58°C to the SentrixMouseWG-6 Expression BeadChip or humanHT-12 Expression BeadChip (>46,000 gene transcripts; Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The library was loaded at 6 pM and sequenced using the Miseq Reagent Kit v3 (600-cycle) (Illumina; catalog no., MS-102-3003).
-
bioRxiv - Immunology 2020Quote: ... The plates were then pooled in equal volumes and the pooled library was then diluted to 6 μM and sequenced using a 500-cycle V3 reagent on an Illumina MiSeq (Illumina, San Diego, CA), which yields 25 million paired reads of 250 base pairs ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Genomics 2020Quote: ... The remaining 1μl re-dissolved contents were tagmented using 0.6 μl TD Tagmentation buffer and 0.3 μl ATM Tagmentation enzyme from Nextera XT DNA Library Prep Kit (Illumina, catalog no. FC-121-1030) for 5min at 55 °C ...