Labshake search
Citations for Illumina :
1 - 50 of 1411 citations for 6 methyl 5 6 7 8 tetrahydro 1 3 dioxolo 4 5 g isoquinolin 6 iumchloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct, n=6; Illumina TruSeq RNA Exome, n=5) was sequenced on one lane on the Illumina HiSeq 3000 platform in the Technology Center for Genomics and Bioinformatics at UCLA ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 pM of DNA library spiked with .5% PhiX viral DNA was clustered on cBot (Illumina) and then sequenced on a HiScanSQ module (Illumina).
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced on the iSeq (cases 1 - 6 and controls) or NovaSeq 6000 (case 7 and controls) (Illumina) using 150nt paired-end reads.
-
bioRxiv - Systems Biology 2024Quote: ... Illumina BeadArrays (mouse WG-6, Illumina) were used to profile the transcriptome of 33 independent EpiSC samples ...
-
bioRxiv - Systems Biology 2024Quote: ... in two growth media conditions (CMAF and Basal)—were profiled by Illumina BeadArrays (mouse WG-6 v2, Illumina). Poor quality profiles were removed ...
-
bioRxiv - Microbiology 2021Quote: ... 6) merged triplicates for DC3000 − (Illumina only), 7 ...
-
bioRxiv - Neuroscience 2023Quote: ... We then randomly selected 2–3 scrambled-injected and 5–6 F0 knockout larvae for sequencing of the targeted loci (see Preparation of samples for Illumina MiSeq).
-
bioRxiv - Cancer Biology 2020Quote: ... and hybridized to BeadChip Array MouseWG-6 (Illumina). Bead chips were scanned with an Illumina BeadArray Reader ...
-
bioRxiv - Systems Biology 2024Quote: ... and hybridized on mouseWG-6 v2 BeadArrays (Illumina). Slides were scanned using an iScan (Illumina SY-101- 1001 ...
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Immunology 2019Quote: ... The indexed samples were multiplexed per 4 or 6 and sequenced on a HiSeq2500 sequencer (Illumina) to produce single-ends 65 bases reads ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added four mate pair libraries (3 kb, 5 kb, 7 kb, 8 kb) prepared using a Nextera Mate Pair Library Prep kit (Illumina, San Diego, CA, USA). Each library was sequenced on an Illumina HiSeq 2500 sequencer by Novogene (Sacramento ...
-
bioRxiv - Neuroscience 2020Quote: ... and hybridized to MouseWG-6 v2.0 Expression BeadChips (Illumina). Raw data were preprocessed with quantile normalization in R/Bioconductor using the package beadarray ...
-
bioRxiv - Developmental Biology 2022Quote: Transposed DNA fragments were purified using the Qiagen MinElute kit and amplified 6-8 cycles using the Nextera (Illumina) PCR primers ...
-
bioRxiv - Genetics 2021Quote: ... 6 μL of denatured PhiX control (prepared according to Illumina protocol, final concentration 1%) was added to the library ...
-
bioRxiv - Genomics 2019Quote: ... Libraries were pooled and sequenced via single end 50 bp reads on a HiSeq 2500 (6 libraries per lane) or HiSeq 4000 (8 libraries per lane)(Illumina).
-
bioRxiv - Genetics 2020Quote: ... and the libraries were sequenced in pools of 6 (Illumina HiSeq2500 high output flow-cell ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 6-digit index primers (Illumina RNA PCR Index Primers RPI1-RPI28) were used instead of 10-digit index primers suggested by the LM-Seq protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index i7 (6 pb barcode) was read with primer HP8 (Illumina).
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6 pM of DNA library spiked with 1% PhiX viral DNA was clustered on cBot (Illumina) and then sequenced on a HiScanSQ module (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced at Novogene on 1 HiSeq PE 150 lane (6 bp, i7 single index, Illumina). The output of the lane was 375 million reads.
-
bioRxiv - Genomics 2019Quote: ... RNAseq libraries were pooled and sequenced via single end 50 bp reads on a HiSeq 2500 (4 libraries per lane) or HiSeq 4000 (6 libraries per lane)(Illumina).
-
bioRxiv - Genetics 2021Quote: ... These 6 cats were sequenced on a HiSeq2500 (Illumina, San Diego, CA) to generate 100bp paired-end reads ...
-
bioRxiv - Neuroscience 2019Quote: ... and sequenced 6 samples per lane on a HiSeq 2000 sequencer (Illumina) giving a depth of 30-35 million reads per sample.
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced at 101×6×0×101 on a HiSeq (Illumina) to a minimum depth of 30 million reads per sample.
-
bioRxiv - Immunology 2021Quote: ... and mixed with 6 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96– Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR amplified cDNA libraries were run on 6% Novex TBE gels (Illumina), and fragments running between 110-160 bp markers were gel-extracted for subsequent purification ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... “alata” [6] from NCBI Sequence Read Archive (seven 101bp paired-end Illumina libraries ...
-
bioRxiv - Neuroscience 2021Quote: Total mRNA samples were used on MouseWG-6 v2.0 Expression BeadChips by Illumina. Differential expression was analyzed using direct hybridization analysis with quantile normalization ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 6 pM with 15% PhiX control DNA v3 (#FC-110-3001, Illumina) and sequenced on a MiSeq System (Illumina).
-
bioRxiv - Immunology 2020Quote: ... Labelled cDNA were hybridised on a MouseWG-6 v2.0 Expression BeadChip (Illumina, USA) and gene expression analysis was performed using Partek software (Partek Incorporated ...
-
bioRxiv - Microbiology 2023Quote: ... with 6 nucleotides library indexes (DNA Single Indexes Set A or B, Illumina). To achieve sufficient variability during the first five sequencing cycles ...
-
bioRxiv - Microbiology 2023Quote: ... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
bioRxiv - Physiology 2022Quote: ... 1A was obtained by DNA microarray using MouseWG-6 v2.0 Gene Expression BeadChips (Illumina).
-
bioRxiv - Genetics 2022Quote: ... in adolescents and Illumina Human-6 Expression Bead Chips (Illumina, Inc. San Diego, CA) in adults ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Developmental Biology 2022Quote: ... 75bp single end sequencing was carried out on 4-6 libraries / genotype using Illumina NextSeq500 High output mode and v2.5 chemistry (Illumina Protocol 15046563 v02, Mar 2016) to collect >25M reads per sample.
-
bioRxiv - Genomics 2019Quote: ... and marker-wise (HWE P value > 1 × 10−6, call rate > 95%, and for the GSA array additionally by Illumina GenomeStudio GenTrain score > 0.6 ...
-
bioRxiv - Genomics 2019Quote: ... was isolated from 1 µg of total RNA and 6 RNA-Seq libraries were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on an Illumina HiSeq 2000 platform at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Microbiology 2023Quote: ... Multiplexing of sgRNA challenge screens in BCBL-1 was performed utilizing 6-bp indexes and sequenced on a single lane of a HiSeq4000 (Illumina) using 50bp single-end (SE ...
-
bioRxiv - Microbiology 2019Quote: ... 1889 and H222Δpox1-6 were sequenced with the Genome Analyzer IIx (Illumina, San Diego, USA) by the Göttingen Genomics Laboratory (G2L ...