Labshake search
Citations for Illumina :
301 - 350 of 1073 citations for 6 Cyclopentadecen 1 one 3 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... in paired-end mode on Illumina (2×101 bp) using TrueSeq DNA exome kit (v.6) (Illumina Inc.). Paired-end reads were aligned to the human reference genome sequence GRCh38 using BWA–MEM (V0.715-r1140 ...
-
bioRxiv - Developmental Biology 2021Quote: ... One microgram of total RNA was used to create each sequencing library using a Truseq RNA Sample Preparation Kit (Illumina, RS-122-2001). Briefly ...
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were then hybridized to the custom HPV capture probes for 72 hours using the Roche target enrichment protocol following manufacture instructions and sequenced on one Illumina HiSeq 2500 lane (Illumina, San Diego, CA) using the paired end 150 bp sequencing mode ...
-
bioRxiv - Immunology 2021Quote: ... 384 purified samples were pooled into one library and then subjected to paired-end sequencing using Illumina MiSeq Nano 300 V2 cycle Kits (Illumina, #MS-103-1001) at a concentration of 12 pM.
-
bioRxiv - Plant Biology 2020Quote: ... One μg of DNase-treated total RNA was used for library construction using TruSeq Stranded mRNA Library Prep Kit (Illumina Inc, CA, USA) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Each pool of V4-V5 16S rRNA amplicons was sequenced (2×300nt paired end) on one lane of a MiSeq V2 sequencer (Illumina, San Diego, CA) at the Carver Biotechnology Center of the University of Illinois ...
-
bioRxiv - Cell Biology 2021Quote: ... and pooled before paired-end 150-base-pair sequencing on one lane of an Illumina NovaSeq 6000 sequencer (Illumina, Inc., San Diego, USA), which generated 3 million reads per samples ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... one RNA pool of 5 livers from each treatment and sex were independently subjected to sequencing (Illumina Novaseq 6000 paired-end (2×150)) ...
-
bioRxiv - Genomics 2022Quote: ... and the library pool was amplified via qPCR and loaded on one lane of a NovaSeq 6000 S4 flowcell (Illumina, San Diego, CA), where it was sequenced for 28 nt from one end and 151 nt from the other end ...
-
bioRxiv - Zoology 2021Quote: ... The library was sequenced with 150 bp paired-end reads in one lane of an Illumina HiSeq X (Illumina, San Diego, CA, USA). The RAD-Seq data were analyzed using the Stacks program (version 2.52 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Libraries pools were and sequenced by Novogene Corporation (Sacramento, California, U.S.A.) on one lane using the Illumina HiSeq 4000 sequencing platform (Illumina Inc, San Diego, California, U.S.A.) producing 150 □bp paired-end reads.
-
bioRxiv - Genomics 2019Quote: ... Libraries were quantitated with qPCR and paired-end sequenced for 150 bases-long reads on one lane of the Illumina HiSeq 4000 (Illumina, San Diego, CA). Library construction and sequencing were carried out at the W.M ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were equimolarly pooled and RNA sequencing was then performed on one S4 lane of the Illumina NovaSeq 6000 instrument (Illumina, San Diego, USA), using the NovaSeq 6000 S4 v1.5 Reagent Kit (300 cycles) ...
-
bioRxiv - Immunology 2023Quote: ... libraries were equimolarly pooled and RNA sequencing was performed on one S4 lane of the Illumina NovaSeq 6000 instrument (Illumina, San Diego, USA), using the NovaSeq 6000 S4 v1.5 Reagent Kit (300 cycles) ...
-
bioRxiv - Molecular Biology 2023Quote: ... we used one lane of a NovaSeq 6000 SP Reagent Kit v1.5 (100 cycles) (Illumina, San Diego, CA, USA, 20028401) (Illumina, San Diego, CA, USA) (1×100 bp) ...
-
bioRxiv - Genomics 2023Quote: ... we normalize all libraries to 10mM and pool all for sequencing using paired-end 2x150 bp reads over one lane of an S4 flowcell on an Illumina NovaSeq 6000 DNA sequencer (Illumina, San Diego, CA) run at the UCSD Institute for Genomic Medicine Genomics Center ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Samples were 2 × 150 bp paired-end sequenced on one lane each of a HiSeq X Ten instrument (Illumina, Inc., San Diego, CA). Samples for Luke and Nababiep were prepared by HudsonAlpha Institute for Biotechnology (Huntsville ...
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Developmental Biology 2022Quote: Transposed DNA fragments were purified using the Qiagen MinElute kit and amplified 6-8 cycles using the Nextera (Illumina) PCR primers ...
-
bioRxiv - Microbiology 2023Quote: For array-based gene expression analysis: Analysis of gene expression was performed using the MouseWG-6 v2.0 array (Illumina), following quality testing of mRNA using an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... scRNA-seq libraries were pooled at equimolar concentration and sequenced to saturation (median 6 reads/UMI) on an Illumina NextSeq 500 sequencer and using high-output 75 cycles v2.5 kits (Illumina), obtaining 483M reads in total ...
-
bioRxiv - Cancer Biology 2019Quote: ... 150 bp insert cDNA libraries were sequenced to a depth of 60 million reads on one Illumina HiSeq 2500 lane (Illumina, Inc., San Diego, CA) using the paired end 150 bp mode ...
-
bioRxiv - Plant Biology 2021Quote: ... A total of 20 RNA-Seq libraries (one per individual) were prepared with the TruSeq RNA Library Preparation Kit v2 (Illumina, San Diego, CA, USA) using 0.5 μg of starting RNA and aiming at a median insert size of ∼ 155 bp (standard fragmentation protocol) ...
-
bioRxiv - Genomics 2022Quote: ... Canada prepared and sequenced four additional libraries: one paired-end (PE) library with 550 bp inserts using a Nano kit (Illumina, San Diego, CA, USA) and three mate-pair (MP ...
-
bioRxiv - Genomics 2021Quote: Six Illumina RNA-Seq libraries (one for each organ) were constructed from 500ng total RNA using the TruSeq Stranded mRNA kit (Illumina, San Diego, CA, USA), which allows for mRNA strand orientation (the orientation of sequences relative to the antisense strand is recorded) ...
-
bioRxiv - Genomics 2022Quote: ... the sequencing was performed with paired-end sequencing of 150nt each end on one lane of Illumina NovaSeq 6000 (Illumina, San Diego, CA, USA) per sample ...
-
bioRxiv - Microbiology 2022Quote: ... A total of 21 isolates were selected (one representative from each cluster) for whole-genome sequencing using the Illumina NovaSeq 6000 (Illumina, San Diego, CA, USA) platform ...
-
bioRxiv - Plant Biology 2023Quote: ... as per manufacturer’s instructions except that reaction volumes were scaled by one-half and 12 PCR cycles were used for library amplification (Illumina, San Diego, California, USA). Paired-end sequencing (2 × 150 bp ...
-
bioRxiv - Genetics 2023Quote: ... Individual libraries were pooled 30-plex at equimolar concentrations and sequenced on one lane of an Illumina HiSeq 2500 (Illumina, Inc, San Diego, CA) employing a paired-end ...
-
bioRxiv - Genomics 2023Quote: ... where all 184 samples were merged into one flow cell and sequenced using 100bp single-end mRNA sequencing (RNA-seq) on Illumina Hiseq 2500 (Illumina, San Diego, CA, USA).
-
bioRxiv - Genomics 2019Quote: ... RNAseq libraries were pooled and sequenced via single end 50 bp reads on a HiSeq 2500 (4 libraries per lane) or HiSeq 4000 (6 libraries per lane)(Illumina).
-
bioRxiv - Genomics 2019Quote: ... Libraries were pooled and sequenced via single end 50 bp reads on a HiSeq 2500 (6 libraries per lane) or HiSeq 4000 (8 libraries per lane)(Illumina).
-
Blind exploration of the unreferenced transcriptome reveals novel RNAs for prostate cancer diagnosisbioRxiv - Genomics 2019Quote: ... above 6 were depleted for ribosomal RNA and converted into cDNA library using a TruSeq Stranded Total Library Preparation kit (Illumina). cDNA libraries were normalized using an Illumina Duplex-specific Nuclease (DSN ...
-
bioRxiv - Genomics 2019Quote: ... The pooled library contained three samples at 6 pM with 9% PhiX and was sequenced with a 50-cycle single-end MiSeq reagent kit (Illumina). The sequencing reads were aligned to the reference genome (NC 000913.3 ...
-
bioRxiv - Microbiology 2020Quote: ... One microgram of gDNA with a DNA integrity number (DIN) of <=6 was used for library preparation using the TruSeq PCR-free library preparation kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and mate-pair libraries of 3 kb and 6 kb insert sizes were prepared using the Nextera Mate Pair Sample Preparation Kit (cat. No. FC-132-1001, Illumina). We then assessed library quality using the HS DNA Kit (Agilent ...
-
bioRxiv - Genomics 2019Quote: ... Sequencing libraries of A and B containing 6 bp indexes were prepared using the TruSeq RNA sample prep kit (Illumina) following a modification of the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... DNA-Seq libraries were prepared using Nextera XT library preparation kit with 700 pg DNA input per sample and 6:30 min tagmentation at 55 °C and barcoded using Nextera XT indexes (Illumina). RNA-Seq libraries were prepared using KAPA RNA HyperPrep kit (Roche ...
-
bioRxiv - Immunology 2023Quote: ... all indexed libraries were pooled with 6% PhiX spike-in DNA and sequenced using a MiSeq Reagent Nano Kit v2 (500 cycles) (Illumina) at the Fralin Genomics Sequencing Center.
-
bioRxiv - Cell Biology 2022Quote: ... Multiplexed libraries for the 1.5 h samples were generated using the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit and for the 6 h samples using TruSeqHT Stranded Total RNA Library Prep protocol (Illumina).
-
bioRxiv - Bioengineering 2023Quote: ... pair-end single index sequencing parameters were adjusted to 101/6/0/86 (as opposed to 74/6/0/86) to effectively utilize the capabilities of the NovaSeq 200 cycle reagent kit (Illumina). To demultiplex each sample and to generate the matrix of transcript counts in each cell ...
-
bioRxiv - Cancer Biology 2024Quote: ... The paired-end reads of 150 bp were generated in an S4 flowcell with v1.5 sequencing chemistry on a NovaSeq-6 000 platform (Illumina Inc.). Read quality was checked by FastQC tool v0.11.9 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...