Labshake search
Citations for Illumina :
101 - 150 of 1073 citations for 6 Cyclopentadecen 1 one 3 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2019Quote: ... One library was prepared for each individual using the TruSeq Stranded mRNA protocol (Illumina) and cDNA was sequenced on an Illumina NovaSeq 6000 to generate an average of 87 million 150 bp paired-end reads per library (Table S1) ...
-
bioRxiv - Genomics 2020Quote: ... The resulting libraries were sequenced with one sample per lane using the NextSeq500 (Illumina; high-output mode ...
-
bioRxiv - Immunology 2021Quote: ... The libraries were multiplexed and sequenced using one flow cell on Novaseq 6000 (Illumina) as 50bp paired-end reads ...
-
bioRxiv - Genomics 2021Quote: ... The pooled final library was sequenced on one to four lanes of HiSeq2000 (Illumina) with 68 base (Y ...
-
bioRxiv - Cancer Biology 2023Quote: ... One barcoded library was prepared per plate using TD buffer and TDE1 enzyme (Illumina) for tagmentation and KAPA HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Genomics 2023Quote: ... cycle one begins with incorporation of the first nucleotide in Incorporation Mix (Illumina MiSeq), followed by incubation with shaking at 60°C for 3 min ...
-
bioRxiv - Plant Biology 2023Quote: ... one microgram of crosslinked enriched chloroplasts was resuspended in 1X Tn5 reaction buffer (Illumina) and assayed according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... and run in one lane on a flow cell of NovaSeq 6000 SP (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplification was carried out using 3 µl of NMP per sample and adding 1 µl of each dual-indexed (i7 and i5; Illumina) primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... CUT&RUN libraries (10–20 Mio reads per sample and 1/3 of reads for the controls) were sequenced on a NovaSeq 6000 (Illumina) paired end 100 bp at the Deep Sequencing Facility (Max Planck Institute for Immunobiology and Epigenetics ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 6-digit index primers (Illumina RNA PCR Index Primers RPI1-RPI28) were used instead of 10-digit index primers suggested by the LM-Seq protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index i7 (6 pb barcode) was read with primer HP8 (Illumina).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Libraries were sequenced on one lane of a HiSeq4000 (PE 150; Illumina San Diego, California).
-
bioRxiv - Genomics 2019Quote: ... four Illumina libraries were prepared and sequenced on a HiSeq2000: one paired-end library (Illumina TruSeq DNA PCR-free LT Sample Prep kit #15036187 ...
-
bioRxiv - Neuroscience 2020Quote: ... mixed in equimolar ratios and sequenced on one flow cell of NovaSeq S Prime (Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... Sequencing was carried out on one lane of an Illumina 2500 Hiseq instrument (Illumina Inc.) using 125 cycle chemistry in paired-end (PE ...
-
bioRxiv - Biochemistry 2020Quote: ... The sample was submitted to one channel of Illumina flow cell and sequenced by Illumina Genome Analyzer (GAII ...
-
bioRxiv - Genomics 2021Quote: ... Metagenomic sequencing was performed on one SP lane of the NovaSeq 6000 sequencing system (Illumina) at the Roy J ...
-
bioRxiv - Cancer Biology 2022Quote: ... the library from patient one was sequenced with an Illumina HiSeq 4000 (Illumina, Berlin, Germany) at the DKFZ Genomics and Proteomics Core Facility in Heidelberg and all other libraries were sequenced on an Illumina NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... one nanogram of DNA was fragmented and adapter ligated using the Nextera XT kit (Illumina) and unique 8bp dual-index adapters (IDT ...
-
bioRxiv - Developmental Biology 2023Quote: ... the libraries were multiplexed into one pool and sequenced using the Illumina HiSeq2500 instrument (Illumina) at National Institute for Basic Biology in Okazaki ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Genetics 2021Quote: ... These 6 cats were sequenced on a HiSeq2500 (Illumina, San Diego, CA) to generate 100bp paired-end reads ...
-
bioRxiv - Neuroscience 2019Quote: ... and sequenced 6 samples per lane on a HiSeq 2000 sequencer (Illumina) giving a depth of 30-35 million reads per sample.
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced at 101×6×0×101 on a HiSeq (Illumina) to a minimum depth of 30 million reads per sample.
-
bioRxiv - Immunology 2021Quote: ... and mixed with 6 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96– Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR amplified cDNA libraries were run on 6% Novex TBE gels (Illumina), and fragments running between 110-160 bp markers were gel-extracted for subsequent purification ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... “alata” [6] from NCBI Sequence Read Archive (seven 101bp paired-end Illumina libraries ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2023Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina and UMI Second Strand Synthesis Module for QuantSeq FWD (Illumina, Read 1) from Lexogen (015.96 and 081.96 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Six barcoded samples were pooled in one lane of the flow cell and sequenced by Illumina NextSeq 750 (MidOutput run) ...
-
bioRxiv - Neuroscience 2019Quote: ... Sequencing was performed on one High-Output lane of an Illumina NextSeq 550 (Illumina, California, USA) in paired-read 150 bp format ...
-
bioRxiv - Cancer Biology 2021Quote: ... one fraction was used for WGS on NovaSeq6000 at PE2×150 cycles (Illumina, San Diego, CA) and another fraction was normalized and pooled at 4 samples from tumor samples and 4 samples for germline samples ...
-
bioRxiv - Cell Biology 2020Quote: ... into an even pool and sequenced across one 2Ø150nt lane of the NovaSeq 6000 (Illumina, CA) at a depth of ∼50,000 reads per cell ...