Labshake search
Citations for Illumina :
401 - 450 of 1869 citations for 6 Chloro N 5 ethoxy 1H pyrazol 3 yl 3 nitropyridin 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: mRNA libraries of the mouse melanoma tumor (n = 12) samples were prepared and sequenced using the HiSeq 2000 (Illumina). RNAseq data were processed by pyflow-RNAseq (Tang ...
-
bioRxiv - Immunology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Cancer Biology 2023Quote: ... All samples were pooled equimolarly and sequenced on a NextSeq 500 High Output v2.5 flowcell (Illumina p/n 20024906) using the Illumina NextSeq 500 sequencing instrument with a single-read configuration (75 bp) ...
-
bioRxiv - Zoology 2023Quote: ... construction using the ONT rapid barcoding kit (SQK-RBK004 or SQK-RBK110.96) or an Illumina MiSeq (n=257) using the Nextera XT Library Preparation kit (Illumina) following the manufacturers’ protocol ...
-
bioRxiv - Microbiology 2019Quote: ... 1889 and H222Δpox1-6 were sequenced with the Genome Analyzer IIx (Illumina, San Diego, USA) by the Göttingen Genomics Laboratory (G2L ...
-
bioRxiv - Microbiology 2019Quote: ... and 2×300bp PE Miseq (Illumina) sequencing at UBC Pharmaceutical Sciences Sequencing Centre (Vancouver ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 × 150 bp flow cells (Illumina).
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% PhiX (PhiX Control v3, Illumina) was spiked into the sample and 20 µL were added to an Illumina iSeq 100 i1 Reagent v2 cartridge ...
-
bioRxiv - Neuroscience 2023Quote: ... and sequencing (Illumina HiSeq 2 × 150bp) were all performed at GeneWiz ...
-
bioRxiv - Biochemistry 2024Quote: ... Round 2 primers (Illumina TruSeq Adapters) were added to each reaction to 400 nM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2×150 cycle strategy (Illumina Inc.). Paired-end reads were produced with a 100x coverage ...
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Developmental Biology 2022Quote: ... The barcode sequencing libraries were quantified by quantitative PCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824). Sequencing libraries were loaded at 18 pM on an Illumina HiSeq2500 using the following read length ...
-
bioRxiv - Molecular Biology 2019Quote: ... or conventional short read RNA-seq of fragmented cDNAs at 20 million (T) or 100 million (N) read depth (Illumina). Full length RNA-seq data were processed using the ToFU platform ...
-
bioRxiv - Genomics 2020Quote: ... The normalised samples (4 nM) were denatured with 0.2 N NaOH and diluted 20 pM using pre-chilled Hybridisation Buffer (HT1) (Illumina, USA). The 20 pM transcriptome libraries were further diluted to 10 pM with pre-chilled HT1 buffer prior to whole transcriptome sequencing on a MiSeq platform.
-
bioRxiv - Cancer Biology 2020Quote: Capture-based next-generation DNA sequencing for cases with sufficient material (n=18) was performed on a NextSeq 500 instrument (Illumina) as previously described13 using a custom brain tumor panel covering the entire coding and selected intronic and promoter regions of 130 or 160 genes of particular relevance in central nervous system tumors ...
-
bioRxiv - Cancer Biology 2022Quote: All 450K array methylation level files were downloaded (Data Type: “Methylation beta value”, Platform: “Illumina Human Methylation 450”; n = 507). The average CpG methylation level over DMRs identified in this study and GENCODE transcript promoters was calculated in all TCGA LUAD and matched normal samples ...
-
bioRxiv - Genomics 2022Quote: All samples (n=75) underwent 16S rRNA gene sequencing using 515F-806R primers on the MiSeq (Illumina, San Diego, USA) as previously described (Seaton et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and colonising (clinical non-CAPA) (C402, C404-C407, C409, C410) isolates from the Netherlands (n=9) were sequenced using NextSeq 550 sequencer (Illumina), and 218 UK and Irish isolates and the five IA isolates (C307 ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from 500 µl of O/N cultures using the Epicentre MasterPureTM DNA purification kit (Illumina Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The resulting sequencing libraries were sequenced using the MiSeq system (Illumina v.2 kit, 2 × 150 bp).
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Immunology 2019Quote: ... The indexed samples were multiplexed per 4 or 6 and sequenced on a HiSeq2500 sequencer (Illumina) to produce single-ends 65 bases reads ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.75 nM libraries were pooled in 6-plex and sequenced on a HiSeq X Ten (Illumina) to produce paired-end 150 bp reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... before combining 6 samples into one flow cell for sequencing on a HiSeq 2000 sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... 6 pM of DNA library spiked with 1% PhiX viral DNA was clustered on cBot (Illumina) and then sequenced on a HiScanSQ module (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced at Novogene on 1 HiSeq PE 150 lane (6 bp, i7 single index, Illumina). The output of the lane was 375 million reads.
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Neuroscience 2019Quote: ... using 2 × 75bp paired-end reads and 2 × 8bp index reads with a 200 cycle kit (Illumina, 20012861). Samples were sequenced at an average of 1.5M reads per cell.
-
bioRxiv - Neuroscience 2019Quote: ... using 2 × 75bp paired-end reads and 2 × 8bp index reads with a 200 cycle kit (Illumina, 20012861). Samples were sequenced at an average of 1.5M reads per cell.
-
bioRxiv - Systems Biology 2021Quote: ... S4 reagent cartridge (2×100 bp) (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... ADNI GO/2 participants (Illumina HumanOmniExpress BeadChip), and ADNI3 participants (Illumina Omni 2.5M ...
-
bioRxiv - Microbiology 2020Quote: ... and sequencing (2 × 150 bp, Illumina HiSeq) were performed by Genewiz (South Plainfield ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, catalog No. MS-102-2003) by the University of Michigan Microbial Systems Molecular Biology Laboratory as described previously (14) ...
-
bioRxiv - Microbiology 2021Quote: ... 2) merged triplicates for DC3000 + (Illumina only), 3 ...
-
bioRxiv - Microbiology 2022Quote: ... generating 2 × 300bp paired-end reads (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... and sequenced on 2×150 Miseq (Illumina). Clonal abundances were estimated using a pipeline adapted from 110 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or SMART-Seq™ 2 (Illumina, 20040532), followed by NovaSeq (RIP-seq experiments from Figs ...
-
bioRxiv - Immunology 2023Quote: ... and HiSeq2500 V2 2×150bp (Illumina®) protocols at the “Institut du Cerveau” (ICM ...
-
bioRxiv - Cell Biology 2023Quote: ... and 20 μM reverse P7 primers with 6-bp TruSeq indices that are automatically demultiplexed by Illumina software ...
-
bioRxiv - Developmental Biology 2022Quote: ... All 6 individual libraries were pooled in equal amount and sequenced with the HiSeq 4000 platoform (Illumina). The RNA-seq data are available under the GEO accession no ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...