Labshake search
Citations for Illumina :
301 - 350 of 1869 citations for 6 Chloro N 5 ethoxy 1H pyrazol 3 yl 3 nitropyridin 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Exome capture was achieved in pools of 3 and subjected to paired end 75 sequencing on a NovaSeq platform (Illumina, San Diego, USA) at 40x depth for blood samples and 80x depth for tumour samples ...
-
bioRxiv - Neuroscience 2024Quote: Libraries were generated using the QuantSeq 3’ (Lexogen) mRNA protocol and subsequently sequenced using the Illumina HiSeq 4000 (Illumina; 50bp single end reads). On average 8.2M reads were obtained for each of the 10 replicate samples collected from each age (6- ...
-
bioRxiv - Microbiology 2022Quote: ... a selection of 288 Enterobacterales recovered from water (n=155) and wastewater (n=133) samples underwent paired-end short read sequencing using Illumina (Illumina, USA) NovaSeq 6000 or MiSeq platforms ...
-
bioRxiv - Genomics 2019Quote: ... and 800 bp) and four mate-pair libraries (2, 6, 10, and 20 Kb) following the standard protocols provided by Illumina (San Diego, USA). Subsequently ...
-
bioRxiv - Developmental Biology 2019Quote: ... or 6 bp (Nextera Index Read 1 Primer/i7) additional base pairs to the 3’ ends of standard Nextera primer sequences [100] (Illumina Inc., San Diego, California). Although we have not confirmed this directly ...
-
bioRxiv - Genetics 2019Quote: ... The coding and splice-site regions of genes susceptible to hereditary arrhythmia and cardiomyopathies(10) were sequenced for probands II:3 and III-7 using Illumina HiSeq2500 Analyzer (Illumina, San Diego, CA, USA)(11) ...
-
bioRxiv - Microbiology 2020Quote: ... first using the differential coverage information from only the same plant as the assembly (i.e. the corresponding 3 Illumina metagenomes 2016, 2017 and 2018), or differential coverage information from all of the Illumina metagenomes (69 in total) ...
-
bioRxiv - Neuroscience 2022Quote: ... Sequencing libraries were prepared by transposase-assisted tagmentation and enrichment of 3’end of genes using Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA, USA). The libraries were sequenced on the HiSeq2500 for 25 and 75 cycles paired-end reads ...
-
bioRxiv - Immunology 2024Quote: ... China), using Chromium Single Cell 3’ Reagent Kits v2 (from 10x Genomics, Pleasanton, CA, USA) and NovaSeq 6000 System (Illumina, San Diego, CA, USA) respectively ...
-
bioRxiv - Systems Biology 2024Quote: ... in two growth media conditions (CMAF and Basal)—were profiled by Illumina BeadArrays (mouse WG-6 v2, Illumina). Poor quality profiles were removed ...
-
bioRxiv - Systems Biology 2024Quote: ... Illumina BeadArrays (mouse WG-6, Illumina) were used to profile the transcriptome of 33 independent EpiSC samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell pellet was then mixed and incubated at 37°C for 1h min with the transposition reaction mix prepared using Illumina Tagment DNA Enzyme and Buffer kits (Illumina, 20034197). DNA was then purified using DNA Clean and Concentrator kit (Zymo ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared following 10X Genomics protocols (Chromium Single Cell 3’ Reagent Kits v2 Chemistry) and sequenced on NovaSeq 6000 (Illumina S2 flow cell, paired-end). FASTQ files were processed using cellranger (https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger ...
-
bioRxiv - Microbiology 2022Quote: ... and R2-Uni13 (5’-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GAG TAG AAA CAA GG-3’) (adaptor and barcode oligonucleotide sequences from Illumina, Inc., San Diego, CA, USA). Annealing and extension steps were performed for 30 s at 55oC and 7 m at 72oC ...
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Genomics 2022Quote: ... 5 μl of Index primer (both provided in NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2), and 25 μl NEBNext Ultra II Q5 Master Mix (PCR cycling conditions ...
-
bioRxiv - Neuroscience 2021Quote: ... We used TruSeq Stranded mRNA kits (Illumina P/N 20020594) to prepare the stranded mRNA libraries ...
-
bioRxiv - Microbiology 2021Quote: ... 6) merged triplicates for DC3000 − (Illumina only), 7 ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting amplicon library pool was diluted to 2 nM with sodium hydroxide and 5 mL were transferred into 995mL HT1 (Illumina) to give a final concentration of 10 pM ...
-
bioRxiv - Genomics 2019Quote: ... and three mate-pair libraries (insert sizes of 2 kb, 5 kb, and 8 kb) were constructed using the TruSeq PCR-free Kit (Illumina) and Mate-pair Kit (Illumina) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The ~2 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina) as previously described [79] ...
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Genetics 2024Quote: ... The libraries were amplified for 5 cycles and sequenced in 2×75-bp paired-end mode with NextSeq 500 sequencing technology (Illumina), per the manufacturer’s recommendations.
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... PhiX Control v3 adapter-ligated library (Illumina p/n FC110-3001) was spiked-in at 1% by weight to ensure balanced diversity and to monitor clustering and sequencing performance ...
-
bioRxiv - Cancer Biology 2020Quote: ... and hybridized to BeadChip Array MouseWG-6 (Illumina). Bead chips were scanned with an Illumina BeadArray Reader ...
-
bioRxiv - Systems Biology 2024Quote: ... and hybridized on mouseWG-6 v2 BeadArrays (Illumina). Slides were scanned using an iScan (Illumina SY-101- 1001 ...
-
bioRxiv - Microbiology 2023Quote: ... The quantified and denatured libraries were sequenced using paired-end 2×250-bp chemistry with 5% PhiX as an internal control on the Illumina MiSeq 2000 platform (Illumina Inc., USA). The quality-filtered reads were de-novo assembled using SPAdes (version 3.11.1) ...
-
bioRxiv - Neuroscience 2020Quote: ... and hybridized to MouseWG-6 v2.0 Expression BeadChips (Illumina). Raw data were preprocessed with quantile normalization in R/Bioconductor using the package beadarray ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... one RNA pool of 5 livers from each treatment and sex were independently subjected to sequencing (Illumina Novaseq 6000 paired-end (2×150)) ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Neuroscience 2020Quote: ... The TruSeq RNA Sample Preparation Kit (Illumina, Cat. N°RS-122-2002, USA) was used for library preparation (1 µg total RNA) ...
-
bioRxiv - Genetics 2020Quote: ... bovis (n=84 genotyped animals retained after quality control of the Illumina reads). Controls were animals which were lesion and culture negative for M ...
-
bioRxiv - Genetics 2020Quote: ... bovis (n=128 genotyped animals retained after quality control of the Illumina reads). An additional Fulani animal was also genotyped but we did not have any information on its M ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Genomics 2021Quote: ... and four mate-pair sequencing libraries (insert sizes of 2, 5, 10, and 15 kb) in accordance with manufacturer protocols (Illumina, San Diego, CA, USA). Libraries were then sequenced using a HiSeq2000 instrument (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... and diluted to 5 pM prior to sequencing on an Illumina MiSeq platform with a 2 × 250 bp paired-end protocol (Illumina, San Diego, CA, USA). Sequencing reads were deposited in the European Nucleotide Archive (ENA ...
-
bioRxiv - Genetics 2020Quote: ... and the libraries were sequenced in pools of 6 (Illumina HiSeq2500 high output flow-cell ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Molecular Biology 2023Quote: ... Index i7 (6 pb barcode) was read with primer HP8 (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 6-digit index primers (Illumina RNA PCR Index Primers RPI1-RPI28) were used instead of 10-digit index primers suggested by the LM-Seq protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Microbiology 2019Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Microbiology 2021Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Cell Biology 2022Quote: ... version 2 (Illumina) using 10 PCR cycles ...