Labshake search
Citations for Illumina :
1 - 50 of 2425 citations for 6 4 Methyl 1 piperazinyl N 5 methyl 1H pyrazol 3 yl 2 1Z 2 phenylethenyl 4 pyrimidinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina) for the second read ...
-
bioRxiv - Genomics 2021Quote: Methyl-seq-captured libraries were sequenced using a Hiseq2500 device (Illumina), by applying paired-end 125bp reads ...
-
bioRxiv - Genomics 2021Quote: The TruSeq Methyl Capture Epic kit was a gift from Illumina. Sequencing libraries were prepared according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct, n=6; Illumina TruSeq RNA Exome, n=5) was sequenced on one lane on the Illumina HiSeq 3000 platform in the Technology Center for Genomics and Bioinformatics at UCLA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Microbiology 2023Quote: ... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
bioRxiv - Genetics 2024Quote: ... libraries were prepared using EpiGnome™ Methyl-Seq reagents (Illumina, Inc, San Diego, CA), index-tagged for multiplexing ...
-
bioRxiv - Genetics 2023Quote: ... The Illumina TruSeq Methyl Capture EPIC library prep kit (Illumina, Santa Clara, CA, USA) was used following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample.
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Genomics 2021Quote: ... All DNA methylation data was generated using the TruSeq Methyl Capture EPIC kit (FC-151-1003, Illumina) according to manufacturer’s protocol [62] ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 ng of ssDNA was used as input for the Epicenter EpiGnome™ Methyl-Seq Kit (Illumina, EGMK81312 ...
-
bioRxiv - Molecular Biology 2022Quote: Equimolar amounts of libraries for Enzymatic Methyl-seq were first sequenced on the iSeq 100 instrument (Illumina) using paired-end sequencing of 2x151 to assess both library and pooling qualities ...
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genetics 2020Quote: ... Libraries were prepared with the Accel-NGS Methyl-Seq DNA Library Kit from Illumina (Cat No. 30096, Swift) and the sequencing was performed at Novogene (Hongkong ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Genetics 2020Quote: Whole genome bisulfite sequencing libraries were generated with the Accel-NGS Methyl-seq DNA Library Kit (Swift Biosciences) and sequenced on a HiSeq X10 (Illumina) in 150bp PE mode with PhiX spike-in to counteract low sequence diversity ...
-
bioRxiv - Cancer Biology 2022Quote: ... resistant and P12 cells of cell lines #3 and #9 was performed at the Genomics and Proteomics Core Facility of the German Cancer Research Center (GPCF DKFZ, Heidelberg) using the TruSeq DNA PCR-free Methyl protocol (Illumina) for library preparation ...
-
bioRxiv - Genomics 2023Quote: ... xGen Methyl-Seq Library kit was purchased from Integrated DNA Technologies and Nextera XT library prep kit was from Illumina, Inc.
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were sequenced using 2 x 150 nt paired-end sequencing runs (4 lanes on separate runs) on NextSeq Genome Sequencer (Illumina) with a NextSeq 500/550 High Output Kit v2.5 at Core Facility for Scientific Research – University of Sao Paulo (CEFAP-USP).
-
bioRxiv - Genomics 2023Quote: ... all samples were pooled at 4 nm concentration and paired-end [300bp (2 × 151bp)] sequenced in MiSeq platform (Illumina, USA).
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were cleaned using Sample Purification Beads from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina, #FC-151-1002) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Genomics 2022Quote: ... Whole genome bisulfite sequencing libraries were prepared (according to Accel-NGS Methyl-Seq DNA library Kit for Illumina protocol, Swift Biosciences) and sequenced in 150 bp paired-end reads by Novogene company.
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were generated from 2-5 μg of genomic DNA using the TruSeq 2 library preparation kit (Illumina, USA). Two types of libraries were prepared ...
-
bioRxiv - Immunology 2019Quote: ... The indexed samples were multiplexed per 4 or 6 and sequenced on a HiSeq2500 sequencer (Illumina) to produce single-ends 65 bases reads ...
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Cancer Biology 2022Quote: ... Post-ligation cleanup proceeded according to Illumina’s instructions with 110 µL Sample Purification Mix from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina catalog # FC-151-1002). After purification ...
-
bioRxiv - Genomics 2022Quote: ... spun at 300G for 12 min at 4 ºC and resuspended in 20 uL transposition mix: 1X TD buffer and 2 uL of TDE1 (Illumina #FC-121-1030), 0.01% Digitonin in DMSO ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Genetics 2019Quote: Genotype information was available for 21,001 NTR participants from 6 different genotyping arrays (Affymetrix 6.0 [N = 8,640], Perlegen-Affymetrix [N = 1,238], Illumina Human Quad Bead 660 [N = 1,439] ...
-
bioRxiv - Genomics 2023Quote: ... coverage and eight additional female genomes (4 Asian and 4 African) at ~30× (1 lane of Illumina Hiseq X Ten) coverage using 10x Linked-Reads at HudsonAlpha Institute of Biotechnology ...
-
bioRxiv - Immunology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were 6-plexed and sequenced with 2×100bp reads on a HiSeq-4000 (Illumina). The data were mapped using BWA ...
-
bioRxiv - Physiology 2022Quote: ... Samples were sequenced on the HiSeq 2500 (Figure 2) or NovaSeq 6000 (Figure 6; Illumina) using a 2×100 kit to a read depth >45 million reads/sample ...
-
bioRxiv - Genomics 2020Quote: ... 64 RNA-Seq libraries (4 time points x 4 tissues x 4 biological replicates) were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on Illumina Nova-Seq 6000 sequencing platform at the Australian Genome Research Facility (AGRF ...