Labshake search
Citations for Illumina :
301 - 350 of 2425 citations for 6 4 Methyl 1 piperazinyl N 5 methyl 1H pyrazol 3 yl 2 1Z 2 phenylethenyl 4 pyrimidinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... and paired end-sequenced (2×75bp) on the HiSeq 2500 (Illumina). Demultiplexing was performed using CASAVA software (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... and sequenced using a MiSeq V2 2×500 reagent kit (Illumina) which was sufficient to overlap and assemble the forward and reverse reads ...
-
bioRxiv - Genomics 2019Quote: ... and sequenced using a MiSeq V3 2×600 reagent kit (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... Libraries were indexed and sequenced over 2 lanes using HiSeq4000 (Illumina) with 75-bp paired end reads ...
-
bioRxiv - Microbiology 2021Quote: ... which was sequenced (2 × 250 bases) using a MiSeq instrument (Illumina) following manufacturer’s protocols.
-
bioRxiv - Plant Biology 2021Quote: ... Parent DNA libraries were sequenced (Illumina HiSeq 2500, 2×101 bp) and aligned to the S ...
-
bioRxiv - Genetics 2019Quote: ... 2) probes annotated to the X and Y chromosomes by Illumina, 3 ...
-
bioRxiv - Microbiology 2021Quote: ... using a 2 × 250 cycle MiSeq Reagent Kit v2 (Illumina Canada). Samples were sequenced in two MiSeq runs and reads were merged in the post sequence analysis.
-
bioRxiv - Neuroscience 2020Quote: ... before it was finally sequenced (2×76bp) on NextSeq 500 (Illumina). Sickle (ver.1.33 ...
-
bioRxiv - Microbiology 2020Quote: ... and subsequently sequenced using HiSeq 2×150 bp cycle kits (Illumina). On average ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... intermedius using a TruSeq RNA sample preparation kit v.2 (Illumina) and run on an Illumina HiSeq1500 with 100 bp single-end reads ...
-
bioRxiv - Microbiology 2020Quote: ... 2×300-bp cycle run on a MiSeq sequencing system (Illumina) and MiSeq Reagent Kit version 3 (600 cycle ...
-
bioRxiv - Molecular Biology 2020Quote: DNA libraries were sequenced (150 bp × 2) with NovaSeq 6000 (Illumina), and the initial 50 bases of each read were aligned to a concatenation of human reference genome (GRCh38 ...
-
bioRxiv - Genetics 2020Quote: Sequencing (Illumina HiSeq 2500, 2 x 50 bp paired-end reads) was performed by the MSKCC Integrated Genomics Operation ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... short-read sequence data (Illumina HiSeq 2×150bp paired-end reads) were ...
-
bioRxiv - Genomics 2020Quote: ... Illumina HiSeq 2500 (2 × 150 bp) platform (Illumina, Dedham, MA, USA) was used for the sequencing of the libraries ...
-
bioRxiv - Molecular Biology 2021Quote: ... diluted to 2 nM and sequenced on HiSeq4000 instrument (Illumina, USA) with 50 bp long reads protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... All libraries were sequenced (2×75 bp) using NovaSeq 6000 (Illumina) according to the standard Illumina protocol.
-
bioRxiv - Microbiology 2022Quote: ... Using the TruSeq RNA Sample Library Preparation v.2 kit (Illumina), RNA was fragmented into small pieces using divalent cations under elevated temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA-sequencing was performed according to manufacturer’s instructions (TruSeq 2, Illumina) using 2µg RNA for preparation of cDNA libraries ...
-
bioRxiv - Neuroscience 2023Quote: ... Read 2: 91 cycles) was conducted on a Novaseq 6000 (Illumina) to achieve a minimum read depth of 20,000 reads per cell for cDNA (gene expression ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Paired-end (2×100) sequencing was performed on a HiSeq (Illumina) by Novogene.
-
bioRxiv - Cancer Biology 2023Quote: ... All libraries were sequenced (2×75 bp) using NovaSeq 6000 (Illumina) according to the standard Illumina protocol.
-
bioRxiv - Genetics 2022Quote: ... using v2 chemistry (2 × 150 bp paired-end reads) (Illumina Inc.).
-
bioRxiv - Genomics 2023Quote: ... before pooling and sequencing (2×150 flow cell - Illumina NovaSeq 6000) at the University of Colorado Anschutz Medical Campus Genomics Core Facility.
-
bioRxiv - Genomics 2023Quote: ... Supplementary Table 2) was subjected to whole-genome sequencing by Illumina HiSeq ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2019Quote: ... and the primers V3F - 5’-CCTACGGGNGGCWGCAG-3’ and V4R – 5’-GACTACHVGGGTATCTAATCC-3’ [28] with the addition of the appropriate Illumina Nextera XT overhang adapter sequences (Illumina, San Diego, CA, USA). Following purification using a magnetic bead capture kit (Ampure ...
-
bioRxiv - Microbiology 2023Quote: ... a 4 nM library was sequenced on the Illumina Nextseq500 platform (Illumina, San Diego, CA) at the Radboudumc sequencing facility ...
-
bioRxiv - Systems Biology 2023Quote: ... allowing 4 lanes of 10x to be sequenced per NovaSeq S1 flow cell (Illumina #20028319) using a 28bp read 1 ...
-
bioRxiv - Genomics 2024Quote: We followed the general GATK version 4 Best Practices to call genetic variants from Illumina RNA-seq data ...
-
bioRxiv - Bioengineering 2019Quote: ... sequencing adaptors and unique dual barcodes combinations were attached to each library PCR amplicons using the Nextera XT Index Kit primers (index 1 N7XX and index 2 S5XX, Illumina, CA), and the amplicon size and concentration were confirmed using a Bioanalyzer (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... Samples were sequenced on an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina, USA) to a depth of approximately 100,000 reads per cell ...
-
bioRxiv - Immunology 2021Quote: ... whose lengths were about 600 base pairs were sequenced using an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina, USA). Only read2 contained the sequence regarding the definition of T cell clones.
-
bioRxiv - Microbiology 2023Quote: ... US) and sequencing (Illumina HiSeq2500 by Illumina, San Diego, CA, US, 2 x 250 bp for peDNA samples and Illumina HiSeq3000, 2 x 150 bp for Filter DNA) was performed at the Max Planck Genome Centre Cologne (MP-GC).
-
bioRxiv - Microbiology 2020Quote: ... Shotgun metagenomic libraries were then constructed from a subset of these animals (LDC N = 15, DDC N = 7, CZMD N = 7) using the Nextera XT kit (Illumina, San Diego, CA USA) and sequenced on and Illumina HiSeq 3000 using a 150bp PE sequencing kit (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... The final libraries were sequenced with 2×250bp on a MiSeq (Illumina). The MiSeq onboard software was used (Real time analysis software v1.18.54 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and sequenced using 2×250 bp paired-end sequencing on MiSeq (Illumina) platform ...
-
bioRxiv - Microbiology 2022Quote: ... Sequencing libraries were prepared with MiSeq reagent kit v.2 (Illumina, USA), targeting mainly dsDNA viruses ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries were sequenced using 2×250bp PE Miseq (Illumina, San Diego, USA) sequencing at Génome Québec Innovation Centre at the McGill University (Montreal ...
-
bioRxiv - Genomics 2020Quote: ... Paired-End Sequencing (2×150bp) was performed on the NovaSeq 6000 (Illumina) with a targeted depth of 2 million reads per sample (∼20,000X coverage).
-
bioRxiv - Genomics 2020Quote: ... and 2×250 bp rapid run mode on HiSeq 2500 platform (Illumina Inc ...
-
bioRxiv - Cancer Biology 2019Quote: ... and sequenced at 2 x 75 bp in a NextSeq500 instrument (Illumina). FASTQ files were aligned to the Homo sapiens/hg19 reference genome using the RNA-seq Alignment tool v1.1.1 in the Illumina’s BaseSpace ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The sequencing was outsourced (GENEWIZ Illumina NovaSeq/HiSeq 2×150 bp sequencing), generating 20 million paired-end reads per replicate ...
-
bioRxiv - Neuroscience 2020Quote: ... Paired end reads (2×100bp) were obtained using the HiSeq 4000 (Illumina).
-
bioRxiv - Microbiology 2021Quote: To process the bacterial sequencing data (Illumina Miseq©, 2*250 bp), we used the FROGS pipeline [15] ...
-
bioRxiv - Microbiology 2022Quote: ... and sequenced using 2×300 bp reads on a MiSeq instrument (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were sequenced using 2×150 cycles on a NovaSeq 6000 (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were sequenced using 2×150 cycles on a NovaSeq 6000 (Illumina).
-
bioRxiv - Developmental Biology 2022Quote: ... paired-end (2 × 150 bp) sequencing on a NovaSeq 6000 platform (Illumina). Raw sequence reads were processed using an in-house developed pipeline ...