Labshake search
Citations for Illumina :
401 - 450 of 2272 citations for 2 Methoxy 2 3 4 5 Tetrabde Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing (2 x 100 bp) was carried out with HiSeq 4000 (Illumina), pooling two patients’ samples on one lane ...
-
bioRxiv - Genomics 2022Quote: ... scherzeri were sequenced with 2×150 bp chemistry on the Illumina MiSeq platform (Illumina), respectively ...
-
bioRxiv - Immunology 2022Quote: ... barcoding and sequencing using HiSeq configured for 2×150 bp paired-end reads (Illumina). An average of 28.9 × 106 paired reads was generated per sample with a mean quality score of 35.81 ...
-
bioRxiv - Plant Biology 2022Quote: ... Paired-end reads (2 × 150 bp) were generation on the HiSeq 3000 platform (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... whole SARS-CoV-2 genome cDNA libraries were generated using a MiniSeq system (Illumina) with a MiniSeq mid-output kit ...
-
bioRxiv - Immunology 2022Quote: Individually indexed libraries were sequenced using the MiSeq V3 2 × 300 cycle system (Illumina). The R1 and R2 reads were processed using the IgDiscover (TCR version) ...
-
bioRxiv - Physiology 2022Quote: ... Libraries were pooled and sequenced paired-ended for 2×75 cycles (Nextseq500 sequencer, Illumina). 30-40 million fragments were generated per sample and quality controls were performed ...
-
bioRxiv - Microbiology 2023Quote: ... The libraries were sequenced (2 × 150 base pairs (bp)) on a MiniSeq System (Illumina). Sequencing reads were aligned with the reference sequences and SHAPE-MaP reactivity profiles for each position was calculated using ‘Shapemapper-2.15’37 with default parameter ...
-
bioRxiv - Immunology 2023Quote: ... and paired end-sequenced on the NovaSeq 6000 (Illumina, read length 2 x 101bp). Adaptor sequences and polyT tails were trimmed from unprocessed reads with fqtrim (v 0.9.7 ...
-
bioRxiv - Pathology 2023Quote: ... Final pool was sequenced using the 2×151 bp P1 reagent (20050264, Illumina, USA) and NextSeq2000 sequencer ...
-
bioRxiv - Microbiology 2023Quote: ... (California, USA) for library prep and 2×150bp sequencing on a NovaSeq6000 (Illumina, USA). The run resulted in 21Gb of data with 140,278,770 raw reads ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced using HiSeq 2000 sequencing with 2 × 150 bp paired-end chemistry (Illumina). On average ...
-
bioRxiv - Microbiology 2023Quote: ... 2 × 1 μl (concentration of 10pmol/μl) MiSeq Nextera XT adapters (dual indexed, Illumina), and 6.5 μl of mQ water (Ultrapure) ...
-
bioRxiv - Cancer Biology 2023Quote: ... libraries were sequenced 2 x 150 paired end using a NovaSeq 6000 instrument (Illumina) to get 30x coverage on the genome ...
-
bioRxiv - Microbiology 2023Quote: ... Transposon mutant 19_H4 was sent for whole genome sequencing (Illumina; 2 X 151 bp) to identify the insertion site of the transposon.
-
bioRxiv - Bioengineering 2023Quote: ... Libraries were then sequenced on NextSeq 500 Mid Output with 2×150 bp (Illumina). The Cell Ranger VDJ pipeline was used for sample de-multiplexing and barcode processing.
-
bioRxiv - Plant Biology 2023Quote: ... Paired-end reads (2 x 150 bp) were on a HiSeq 3000 instrument (Illumina). Sequencing reads were first quality trimmed and filtered with Trimmomatic (version 0.36 ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced with 2×150 bp paired-end reads on a NovaSeq platform (Illumina).
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of each P5 and P7 primer (Nextera Index Kit, Illumina, CA, USA), 2 μl of initial PCR product ...
-
bioRxiv - Neuroscience 2024Quote: ... using 2 NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Two Nextseq runs were performed to compile enough reads (19-32 million pass-filter reads).
-
bioRxiv - Microbiology 2024Quote: ... using the Illumina MiSeq platform with a read length of 2 × 150 bp (Illumina). A subset of 100,000 reads was sampled for each phage ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... Libraries were subsequently sequenced on a NovaSeq S2 Flowcell (paired end 2×56bp) (Illumina). All samples in this study were prepared and sequenced at the same time ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were pooled and sequenced in (2 x 100bp) on the NovaSeq-6000 (Illumina). Gene and ERV expression was quantified as described (11,31 ...
-
bioRxiv - Genetics 2023Quote: ... Plasma was divided from maternal peripheral blood (5[mL) by centrifuging and then 600[μL (Ion Torrent) or 1.4 mL (Illumina CN500) plasma was used to extract cell-free DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Systems Biology 2023Quote: ... 200-500 ng DNA was used for genotyping using the Infinium Omni2.5-8v1-4 and the Infinium Omni2.5-8v1-5 Genotyping BeadChip (Illumina) at the UCSD IGM core ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA libraries were prepared from 1 ug RNA (TruSeq Stranded Total RNA Library Prep Kit, Illumina) and 100 bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA libraries were prepared from 1 ug RNA (TruSeq Stranded Total RNA Library Prep Kit, Illumina) and 100 bp ...
-
bioRxiv - Cancer Biology 2021Quote: ... Concurrently 1 ug total RNA was prepped for RNA sequencing according to the manufacturer’s instructions (Illumina). Analysis was performed as described previously1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA samples were further processes according to the TruSeq Sample Preparation v.2 Guide (Illumina) and paired end-sequenced on the HiSeq 2500 (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... Small RNA libraries were diluted to 2 nM and run on a miSeq System (Illumina) for NGS using the V2 kit (Illumina) ...
-
bioRxiv - Genetics 2021Quote: ... Libraries were then sequenced with 2×150bp paired-end reads on an Hiseq3000 instrument (Illumina).
-
bioRxiv - Genetics 2021Quote: ... Libraries were prepared with a TruSeq RNA Library Prep Kit version 2 (Illumina RS-122) and sequenced on an Illumina HiSeq4000 in paired-end mode (PE150).
-
bioRxiv - Evolutionary Biology 2021Quote: ... with 300 cycle mid-output (2×150 bp) NextSeq Reagent kits v2 (Illumina Corporation, 20024905). FASTQ files of raw sequencing data were deposited in NCBI database with the Sequence Read Archive (SRA ...
-
bioRxiv - Developmental Biology 2021Quote: ... followed by paired-end sequencing (2 x 75 bp) performed with Nextseq 500 (Illumina, USA). Libraries were sequenced in triplicate ...
-
bioRxiv - Genomics 2020Quote: ... The samples were then sequenced (2×101 cycles, paried end reads) on the HiSeq2500 (Illumina) using the TruSeq SBS Kit v3-HS 200 cycles Kit (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2×150bp paired-end sequencing (PE150) was performed on an Illumina Novaseq™ 6000 (Illumina) following the vendor’s recommended protocol.
-
bioRxiv - Genomics 2020Quote: ... Paired end libraries (2×150 bp) were sequenced on an Illumina HiSeq4000 instrument (Illumina Inc.).
-
bioRxiv - Genomics 2020Quote: ... Paired-reads (2×100 bp) were sequenced on the NovaSeq 6000 S2 flowcell (Illumina, Inc.). DNA and RNA library preparation and sequencing were performed at the SNP&SEQ Technology Platform in Uppsala ...
-
bioRxiv - Microbiology 2020Quote: ... and sequenced as 2 × 150 base pair reads on the Illumina NextSeq 550 instrument (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... and sequenced with 2×250 bp cycles of v2 Miseq chemistry (Illumina, San Diego, CA). Replicate reactions from each sample were pooled and gel purified using the Blue Pippin Prep system (Sage Science ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and small-scale sequencing (2 x146bp) on an iSeq platform (Illumina, San Diego, CA, US). Subsequent equimolar pooling of individual libraries from each plate was performed prior to performing large-scale paired-end sequencing (2 × 146 bp ...
-
bioRxiv - Microbiology 2021Quote: ... and sequenced as 2 × 150 base pair reads on the Illumina NextSeq 550 instrument (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: ... and paired-ended [2×150 bp] sequencing was performed on NovaSeq 6000 sequencing system (Illumina). Once the sequencing run was completed ...
-
bioRxiv - Microbiology 2021Quote: ... 100x coverage using a high-output paired end 2 x 150 sequencing regent kit (Illumina).
-
bioRxiv - Synthetic Biology 2022Quote: ... read length 2 × 175 bp using the MiSeq platform (Illumina Inc., San Diego, CA, USA). The library preparation and sequencing were performed in the Institute of Genomics Core Facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 x 150 cycles (NextSeq 500/550 Mid Output v2 kit, Illumina, San Diego, CA).