Labshake search
Citations for Illumina :
251 - 300 of 2272 citations for 2 Methoxy 2 3 4 5 Tetrabde Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2019Quote: ... and the primers V3F - 5’-CCTACGGGNGGCWGCAG-3’ and V4R – 5’-GACTACHVGGGTATCTAATCC-3’ [28] with the addition of the appropriate Illumina Nextera XT overhang adapter sequences (Illumina, San Diego, CA, USA). Following purification using a magnetic bead capture kit (Ampure ...
-
bioRxiv - Molecular Biology 2020Quote: ... the NEBNext Ultra II DNA Library Preparation kit was used to generate libraries using 5-10 ng of input or immunoprecipitated DNA and barcode adaptors (NEBNext Multiplex Oligos for Illumina (Set 1, E7335 and Set 2, E7500)) ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Microbiology 2023Quote: ... US) and sequencing (Illumina HiSeq2500 by Illumina, San Diego, CA, US, 2 x 250 bp for peDNA samples and Illumina HiSeq3000, 2 x 150 bp for Filter DNA) was performed at the Max Planck Genome Centre Cologne (MP-GC).
-
bioRxiv - Cancer Biology 2021Quote: ... The final libraries were sequenced with 2×250bp on a MiSeq (Illumina). The MiSeq onboard software was used (Real time analysis software v1.18.54 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and sequenced using 2×250 bp paired-end sequencing on MiSeq (Illumina) platform ...
-
bioRxiv - Microbiology 2022Quote: ... Sequencing libraries were prepared with MiSeq reagent kit v.2 (Illumina, USA), targeting mainly dsDNA viruses ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries were sequenced using 2×250bp PE Miseq (Illumina, San Diego, USA) sequencing at Génome Québec Innovation Centre at the McGill University (Montreal ...
-
bioRxiv - Genomics 2020Quote: ... Paired-End Sequencing (2×150bp) was performed on the NovaSeq 6000 (Illumina) with a targeted depth of 2 million reads per sample (∼20,000X coverage).
-
bioRxiv - Genomics 2020Quote: ... and 2×250 bp rapid run mode on HiSeq 2500 platform (Illumina Inc ...
-
bioRxiv - Cancer Biology 2019Quote: ... and sequenced at 2 x 75 bp in a NextSeq500 instrument (Illumina). FASTQ files were aligned to the Homo sapiens/hg19 reference genome using the RNA-seq Alignment tool v1.1.1 in the Illumina’s BaseSpace ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The sequencing was outsourced (GENEWIZ Illumina NovaSeq/HiSeq 2×150 bp sequencing), generating 20 million paired-end reads per replicate ...
-
bioRxiv - Cancer Biology 2020Quote: ... with MiSeq Reagent Kit V3 (150 cycle) (Illumina, MS-1-2-3001). The sequencing data was de-multiplexed and trimmed to contain only the sgRNA sequence cassettes ...
-
bioRxiv - Neuroscience 2020Quote: ... Paired end reads (2×100bp) were obtained using the HiSeq 4000 (Illumina).
-
bioRxiv - Microbiology 2021Quote: To process the bacterial sequencing data (Illumina Miseq©, 2*250 bp), we used the FROGS pipeline [15] ...
-
bioRxiv - Microbiology 2022Quote: ... and sequenced using 2×300 bp reads on a MiSeq instrument (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were sequenced using 2×150 cycles on a NovaSeq 6000 (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were sequenced using 2×150 cycles on a NovaSeq 6000 (Illumina).
-
bioRxiv - Developmental Biology 2022Quote: ... paired-end (2 × 150 bp) sequencing on a NovaSeq 6000 platform (Illumina). Raw sequence reads were processed using an in-house developed pipeline ...
-
bioRxiv - Cell Biology 2022Quote: ... Library preparation (NexteraXT kit) and paired-end sequencing (Illumina HiSeq, 2×150bp) was performed by Azenta Life Sciences (Indianapolis ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 x 150 pair-end sequencing was performed using the HiSeq2500 (Illumina) with recommended protocol ...
-
bioRxiv - Genomics 2020Quote: ... with the respiratory virus oligo panel including SARS-CoV-2 probes (Illumina, San Diego ...
-
bioRxiv - Developmental Biology 2020Quote: ... and paired end-sequenced (2×75 bp) on the HiSeq 2500 (Illumina). Experiment 1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The sequencing was outsourced (GENEWIZ Illumina NovaSeq/HiSeq 2×150 bp sequencing), generating a 20 million paired-end reads per replicate ...
-
bioRxiv - Immunology 2020Quote: ... using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3). Sequence analysis and assembly of lineage trees were performed using an in-house custom analysis pipeline as previously described (39 ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by the addition of 25 µl of 2× TD buffer (Illumina) and 7.5 µl of Nextra Tn5 transposase (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 stocks were deep sequenced on a MiSeq platform (Illumina). SARS-CoV-2 whole-genome amplicon-based sequencing was conducted by adapting an existing whole genome sequencing pipeline for poliovirus genotyping as described (Wang et al. ...
-
bioRxiv - Immunology 2022Quote: ... with the NextSeq 500/550 High Output 2×75 cycles kit (Illumina). All sequenced samples were quality assessed by capillary electrophoresis with the Agilent RNA 2100 Nano kit (Bioanalyzer ...
-
bioRxiv - Microbiology 2023Quote: ... The retained libraries were sequenced using MiSeq V3 (2 × 300 bp) (Illumina).
-
bioRxiv - Systems Biology 2023Quote: ... The paired-end sequencing (150 bp × 2) was performed with Novaseq6000 (Illumina) by Chemical Dojin Co ...
-
bioRxiv - Plant Biology 2023Quote: ... and sequencing was performed using MiSeq 2 × 250 cycle paired-end (Illumina) with the Nano Kits v3 reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... depending on library complexity) or NovaSeq (SP 2×250 cycles) platform (Illumina).
-
bioRxiv - Genomics 2023Quote: ... followed by paired-end sequencing (2 × 150 bp) on a NextSeq2000 (Illumina) instrument ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were paired-end sequenced (2×75 bp) on a NextSeq500 (Illumina). BclToFastq was used for the preprocessing of the raw data (trimming and filtering) ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced (paired-end 2×75-bp) in a NextSeq500 instrument (Illumina). Alignment to the reference genome sequence of Listeria monocytogenes EGDe (RefSeq ...
-
bioRxiv - Immunology 2023Quote: ... We sequenced the libraries on 2 lanes of a NovaSeq S4 (Illumina), aligned using CellRanger (10X Genomics ...
-
bioRxiv - Cancer Biology 2023Quote: ... or paired-end (2 × 100 bp) on the Novaseq 6000 platform (Illumina).
-
bioRxiv - Genomics 2023Quote: ... the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA) was used for library preparation following the low-throughput protocol ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: ... 25 mL of 2x NEBNext Ultra II Q5 Master Mix, 3 mL of 10 mM Universal PCR primer from Illumina, 3 mL of 10mM Index PCR primer and 9 mL of nuclease-free water and amplified for 10 cycles (98C for 10 s ...
-
bioRxiv - Genomics 2019Quote: ... We reverse transcribed 1 ug of total RNA with the partial P7 adapter (Illumina_4N_21T) and dNTPs with the addition of spiked-in azido-nucleotides (AzVTPs ...
-
bioRxiv - Genomics 2020Quote: ... De-multiplexing of RNA-Seq reads was conducted using bcl2fastq v.2 (Illumina). Both DNA-Seq and RNA-Seq reads were submitted to FastQC 51 for quality validation.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 × 36 base paired-end sequencing was performed with a NextSeq500 sequencer (Illumina) by Tsukuba i-Laboratory LLP (Tsukuba ...
-
bioRxiv - Immunology 2021Quote: ... Sequencing had been performed by a 300*2 paired-end kit by Illumina MiSeq ...
-
bioRxiv - Bioengineering 2019Quote: ... and the sequencing was run with a 2×250 bp MiSeq run (Illumina).
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were sequenced (paired-end, 2 × 75 cycles) on NextSeq platform (Illumina Inc.) Fastq underwent to Quality Control using FastQC tool (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) ...
-
bioRxiv - Genomics 2021Quote: ... Each batch was sequenced separately on 1-flowcell (2 lanes) HiSeq 2500 (Illumina) Rapid Mode platform with a single-end (1×50 bp ...
-
bioRxiv - Neuroscience 2021Quote: ... The libraries were sequenced paired ended (2×75bp) on the NextSeq500 instrument (Illumina) to an average of at least 33 million reads ...