Labshake search
Citations for Illumina :
401 - 450 of 1461 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... initially with primers containing the adaptors (Universal adaptors; Illumina) and subsequently another 8-12 PCR cycles with the specific primers (Illumina Nextera XT index kit) ...
-
bioRxiv - Genomics 2020Quote: ... using the 96-well plate Nextera indexing primers (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... ATAC-seq libraries were amplified with Nextera primers (Illumina) by PCR and purified with AMPure beads (Beckman Coulter) ...
-
bioRxiv - Neuroscience 2022Quote: ... The primers used for indexing were obtained from Illumina, and the libraries were quantified and QC was done using the KAPA Library Quantification Kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primer indices were used in the reaction from Illumina (Nextera index primers i7 and i5 ...
-
bioRxiv - Microbiology 2023Quote: ... Primers were bar-coded using TruSeq Index Adapters (Illumina), allowing the mixing of samples from different individuals when sequencing PCR products using NextSeq sequencers (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Dual index primer-Multiplex Oligos (Cat# E7600S, Illumina).
-
bioRxiv - Genetics 2023Quote: ... using PCR primers ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAGAAGCAGCTCGACGC and GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGCTGCCGGAAGTGCT (Illumina adapters underlined) and Phire DNA polymerase (Thermofisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse and forward amplicon PCR primers recommended by Illumina were used (16s Amplicon PCR Forward Primer= TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2023Quote: ... and Index primer i5 (Illumina, FC-131-2001/2002) was combined with 12.5μl of the tagmented amplicon DNA ...
-
bioRxiv - Immunology 2024Quote: ... with dual indexing primers (Illumina, Cat#FC-131-2004) to generate a sequencing library ...
-
bioRxiv - Physiology 2024Quote: ... The adaptors and sequencing primers were obtained from Illumina. The libraries were sequenced by Novogene using the NovaSeq 6000 (PE150 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µL of 10 µM RPI-X primer (Illumina), 1 µL of 10 µM P5-TSO primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Beta-values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). All samples were checked for duplicates by pairwise correlation of the genotyping probes on the 450k/EPIC array ...
-
bioRxiv - Cancer Biology 2020Quote: ... Beta-values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). All samples were checked for duplicates by pairwise correlation of the genotyping probes on the 450k/850k array ...
-
bioRxiv - Cancer Biology 2023Quote: ... We used the pan-cancer batch-corrected normalized gene expression and beta values for methylation from Illumina’s HumanMethylation450 BeadChip ...
-
bioRxiv - Cell Biology 2023Quote: ... beta values were calculated from the retransformed intensities using an offset of 100 (as recommended by Illumina). Out of 865,859 probes on the EPIC array ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR reactions were performed using the Thunderbird® SYBR qPCR mix (TOYOBO) and Eco Real-Time PCR System (Illumina). The PCR primers used are listed in Supplementary Table S8 ...
-
bioRxiv - Genomics 2024Quote: ... 11 μL Nuclease-free water and 2 μL RP1 and RPIx primers each (10 mM, for details see Illumina smallRNA indexing primer sequences) to the 10 μL single-stranded DNA product ...
-
bioRxiv - Cancer Biology 2021Quote: ... The captured libraries were sequenced to achieve a mean unique coverage of at least 1000x using Illumina v.4 chemistry and paired-end 100-base pair (bp) reads (HiSeq, Illumina).
-
bioRxiv - Evolutionary Biology 2020Quote: ... in the pair-end mode using HiSeq Rapid Pair-end Cluster Kit v2 and HiSeq Rapid SBS Kit v2 500 cycle kit (Illumina) reagents ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were single end (75bp) or pair-end sequenced at 36 bp by 36 bp on a Nextseq550 flow cell (Illumina).
-
bioRxiv - Cell Biology 2021Quote: ... The remaining RNA fragments were used to construct a strand-specific cDNA library using the dUTP method (average library insert size was 300 ± 50 bp) and pair-end sequencing was performed using the Hiseq 4000 (Illumina) following the manufacturer’s recommended protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... Equal amounts of each library were combined and sent to the Genomic Analysis Platform (IBIS, Quebec, Canada) for pair-end 300bp sequencing on a MiSeq (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... The pooled exome libraries were distributed across four lanes on an S4 flow cell and sequenced using 150 base pair paired-end approach on a NovaSeq 6000 instrument (Illumina). All sequencing was performed on the Illumina NovaSeq 6000 platform by loading a pool samples to the equivalent loading of 24 samples per flowcell ...
-
bioRxiv - Cell Biology 2021Quote: ... and sequenced using the pair-end 76bp protocol at about 520 million reads per library using the NovaSeq platform (Illumina) per the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR amplicons were generated from the plasmids using primer pairs oKAC1589/oKAC1590 (for the catalytic domain) or oKAC1591/oKAC1592 (for the PI domain) and sequenced on a MiSeq (Illumina) to a depth of 12,378 and 409,221 reads for the catalytic and PI domain libraries ...
-
bioRxiv - Immunology 2020Quote: ... The final product was quantified by Bioanalyzer Agilent DNA 1000 and pooled together in equal molar ratio and pair-end sequenced by using MiSeq (Illumina) with MiSeq Reagent Kit V3 150-cycle (Illumina).
-
bioRxiv - Immunology 2022Quote: ... whose lengths were about 600 base pairs were sequenced using an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina). Only read2 contained the sequence regarding the definition of T cell clones.
-
bioRxiv - Immunology 2020Quote: ... Libraries were then pooled at equal molar concentration (Fig. S5) and sequenced on an Illumina NextSeq 500 sequencer to obtain a total of 941M read pairs (Illumina). An average of 78M read pairs per sample were generated with a standard deviation of 10.7M read pairs ...
-
bioRxiv - Genomics 2020Quote: ... At least 4 μg of genomic DNA from each accession was used to construct pair-end sequencing libraries with insert sizes of approximately 300-bp or 500-bp following the manufacturer’s instructions (Illumina Inc.) (Supplemental Table 1) ...
-
bioRxiv - Immunology 2020Quote: ... RNA libraries were then prepared from two biological replicates per condition and samples were sequenced using 75 base pair single-end reading on HiSeq 2500 high-output instrument (Illumina). The raw reads were then subjected to trimming by Trim Galore (https://github.com/FelixKrueger/TrimGalore ...
-
bioRxiv - Immunology 2020Quote: ... and sequenced across 75 base pairs (bp) using a paired-end strategy with a 150-cycle high-output flow cell on a NextSeq 550 (Illumina). Three biological replicates were sequenced per experiment ...
-
bioRxiv - Genetics 2021Quote: ... pooled and subjected to cluster and pair-read sequencing was performed for 150 cycles on a HiSeqX10 instrument (Illumina, USA), according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: ... and five rounds of Pilon (raw PacBio reads mapped with minimap2, 150 bp Illumina read pairs mapped with BWA-mem). This gave rise to assembly version 1.1.
-
bioRxiv - Developmental Biology 2021Quote: ... that provided a standard Illumina mRNA library and generated 150 bp pair-end reads on an Illumina HiSeqX and HiSeq4000 (Illumina), respectively ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were diluted and pooled equimolar and then sequenced in pair end 50 cycles (PE50) on a v4 flowcell (Illumina - HiSeq PE Cluster Kit v4 cBot - PE-401-4001 ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were base-pair selected based on Agilent 2100 Bioanalyzer profiles and normalized determined by KAPA Library Quantification Kit (Illumina). The libraries were built from 5 different mice per genotype ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA libraries were sequenced at pair-end on NextSeq 500 Sequencer with Illumina NextSeq 500/550 high output kit v2.5 (150 cycles) (Illumina, 20024907). Salmon was used to map and quantify the reads against the worm database WS268 ...
-
bioRxiv - Genomics 2021Quote: ... using the TruSeq DNA PCR-free library prep kit with fragments of 150 bp and ii.) Nextera Mate Pair library prep with fragments of 2,000 bp (Illumina, USA). The short-read paired-end libraries were sequenced in two independent lanes and the mate-pair library in one lane using the Illumina HiSeq4000 platform (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequencing libraries were prepared using the QuantSeq 3’mRNA-seq Library Prep Kit FWD for Illumina (Lexogen, Vienna, Austria) and sequenced as single-end 75 base pair reads using the NextSeq 500 (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... Equimolar amounts of these barcoded amplicon-sequencing libraries were pooled and sent to the University of British Columbia’s BRC-Seq Next-Gen Sequencing Core for sequencing using the MiSeq platform with 300-bp pair-end chemistry (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... library preparation was performed using a modified single-cell whole-genome sequencing protocol and 77 base pair single reads were generated using a NextSeq 500 sequencing instrument (Illumina). From each assessed case ...
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Equal amounts of each library were combined and sent to the Genomic Analysis Platform (CHUL, Quebec, Canada) for pair-end 250 bp sequencing on a NovaSeq (Illumina).
-
bioRxiv - Genomics 2024Quote: ... Barcoded libraries were sequenced to a read depth of 30 million 150 base pair paired-end reads using the Novaseq 6000 (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... Libraries were sequenced on the Illumina NextSeq500 platform with paired ends for 2 x 150-base pair reads using a Mid-output cartridge Kit v2.5 (Illumina, 20024905). bcl2fastq software was used to demultiplex and compress bcl files into fastq (gz ...
-
bioRxiv - Cancer Biology 2023Quote: ... we performed single-nucleus indexing by dispensing 600 nL of Nextera PCR Master Mix (NPM) and 400 nL of a unique Nextera index pair (Illumina, cat ...
-
bioRxiv - Microbiology 2023Quote: ... Resulting libraries were pooled with the aim of generating 1×106 raw reads per specimen and sequenced producing paired 74 base pair reads on the Illumina MiniSeq or iSeq instruments (Illumina Inc ...