Labshake search
Citations for Illumina :
401 - 450 of 1011 citations for Fc Receptor Like Protein 3 FCRL3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... 570 μL of denatured library DNA and 30 μL of denatured PhiX control library (Illumina, FC-110-3001) were mixed ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were then transposed for 30 min at 37C with adaptor-loaded Nextera Tn5 (Illumina, Fc-121-1030). Transposed fragments were directly PCR amplified and Sequenced on an Illumina NextSeq 500 platform to generate 2 x 36-bp paired-end reads.
-
bioRxiv - Neuroscience 2021Quote: ... Purified amplicons were prepared for sequencing using the Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1001) using 1 ng of purified amplicon library per sample ...
-
bioRxiv - Neuroscience 2020Quote: ... Full-length cDNA was then processed with a Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). This kit aims to fragment and add adapter sequences onto template DNA with a single tube Nextera XT tagmentation reaction and so generate multiplex sequencing libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-sequencing was performed using NextSeq75 High Output v2 kit and NextSeq 500 (Illumina; cat# FC-404-2005). Using TruSeq 3’ SE adaptor sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... A second PCR step was performed with Illumina Nextera XT Index Kit v2 (Illumina, Cat.:FC-131-2001) and Ex Taq DNA Polymerase (TaKaRa Bio ...
-
bioRxiv - Physiology 2022Quote: ... Samples were pooled and sequenced on the Illumina NextSeq 500/550 High Output platform (Illumina, FC-404-2002) up to 18 samples per lane with 1% PhiX spike as a control.
-
bioRxiv - Plant Biology 2021Quote: ... the Tn5 reaction was prepared and mixed well with nuclei using the Nextera reagents (Illumina, FC-121-1030) as follows ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were pooled in equimolar concentrations and sequenced using an Illumina NextSeq 500 sequencer (Illumina, FC-404-2005). At least 95% of the reads generated presented a Q score of ≥ 30 ...
-
bioRxiv - Neuroscience 2020Quote: ... The full-length cDNA output was processed with Nextera XT DNA library preparation kit (Illumina #FC-131-1024) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... The nuclei were resuspended in the transposition reaction mix (2x TD Buffer (Illumina Cat #FC-121-1030, Nextera), 2.5⍰μl Tn5 Transposase (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were then prepared following the instructions of the TruSeq DNA Sample Preparation Kit (Illumina, #FC-121-2001) and sequenced on the HiSeq 2000 ...
-
bioRxiv - Genomics 2021Quote: ... Each sample library was uniquely barcoded and quantified by qPCR using a PhiX Control (Illumina, FC-110-3001) standard curve ...
-
bioRxiv - Genetics 2021Quote: ... DNA libraries for whole genome sequencing were prepared with Nextera DNA Library Prep Kit (FC-121-1031, Illumina). Libraries for RADseq were prepared according to the procedures of Adapterama III74 with few modifications ...
-
bioRxiv - Genetics 2021Quote: ... and Illumina libraries were prepared with different indexes using Nextera XT Library Prep Kit (Illumina, FC-131-1096). Prior to sequencing ...
-
bioRxiv - Physiology 2021Quote: Sequencing libraries were prepared using the Illumina Nextera XT DNA Sample Preparation kit (Illumina, Ref. FC-131-1096) and the combination of 384 Unique Dual Indexes (Illumina-Set A to D ...
-
bioRxiv - Neuroscience 2020Quote: ... Approximately 50.000 nuclei were used for the transposition reaction using hyperactive Tn5 transposase (Illumina Cat #FC-121-1030) followed by 13 cycles of PCR amplification ...
-
bioRxiv - Immunology 2020Quote: ... the sequencing library was then created from cDNA using the Illumina Nextera XT method (Illumina FC-131-1096). All libraries were combined and sequenced on Illumina HiSeq4000 lanes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Nuclei were then resuspended in transposase reaction mix for 30 min at 37 °C (Illumina, Fc-121-1030). The samples were purified using Qiagen MiniElute kit (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... we used 0.2ng of cDNA per cell and one-eighth of the Illumina NexteraXT (Illumina FC-131-1096) reaction volume ...
-
bioRxiv - Developmental Biology 2022Quote: ... nuclei were extracted from cells and treated with transposition mixture containing Nextera Tn5 Transposase (Illumina, FC-121-1030) for 30 minutes at 37°C with 1000 RPM mixing ...
-
bioRxiv - Cancer Biology 2022Quote: ... before being processed for Illumina sequencing via the Nextera XT DNA Library Preparation kit (Illumina; FC-131-1096). Sequencing was performed on an Illumina platform.
-
bioRxiv - Genomics 2022Quote: ... Nuclei pellets were resuspended in 50 μL transposition reaction containing 2.5 μL Tn5 transposase (FC-121-1030; Illumina). The reaction was incubated in a 37°C heat block for 45 min ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 µL primer P5 (5 µM) and 2.5 µL Index 1 primer (N7**, Illumina, CN FC-131-2001) was used for the PCR enrichment ...
-
bioRxiv - Neuroscience 2022Quote: Sequencing libraries were prepared using the Illumina Nextera XT DNA Sample Preparation kit (Illumina, Ref. FC-131-1096) and the combination of 384 Combinatorial Dual Indexes (Illumina-Set A to D ...
-
bioRxiv - Microbiology 2024Quote: ... DNA for Illumina sequencing was prepared using the Nextera XT DNA library prep kit (Illumina FC-131-1096) with the Nextera XT v2 Index Kit B (Illumina FC-131-2002 ...
-
bioRxiv - Genetics 2024Quote: ... The 0.2 M NaOH was used to denature the pooled library and PhiX library (Illumina, FC-110-3001). After diluting the libraries with pre-chilled HT1 to 12 pM ...
-
bioRxiv - Microbiology 2023Quote: Adapter ligation and barcoding were performed using the Nextera XT Index Kit (#FC-131-1002, Illumina®, UK). PCR conditions involved 3 min of denaturation at 98°C ...
-
bioRxiv - Synthetic Biology 2023Quote: The sequencing libraries were mixed with 20–30% of PhiX spike-in DNA control (Illumina #FC-110-3001) for better cluster generation on the flow cell and sequenced by Illumina MiSeq (MiSeq v3 150-cycles kit #MS-102-3001 or 300-cycles kit #MS-102-3003) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Pooled amplicons were then sequenced on an Illumina MiniSeq system (300 cycles, Illumina sequencing kit #FC-420-1004) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: Next-generation sequencing libraries were prepared using the Nextera XT DNA Library Preparation Kit (FC-131-1096, Illumina). Following fluorometric quantification ...
-
Planarians employ diverse and dynamic stem cell microenvironments to support whole-body regenerationbioRxiv - Developmental Biology 2023Quote: Subsequent library preparation was performed according to manufacturer’s directions for the Nextera XT kit (Illumina, FC-131-1096) starting with 600 pg of cDNA and using a specific P5-Truseq PCR hybrid oligo in place of the Nextera XT i5 adapter (15ul Nextera PCR mix ...
-
bioRxiv - Genomics 2022Quote: ... 2.5 μL each of Nextera i5 and i7 indexed amplification primers (Nextera Index Kit, Illumina, FC-121—1011) and 10 μl of nuclease free H2O ...
-
bioRxiv - Genomics 2022Quote: ... To the 1.5 μl concentrated air DNA extraction we added 2.5 μl Illumina Nextera reaction buffer (FC-121-1030, Illumina), 1 μl 1 pg/μl Lambda DNA (SD0011 ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries for ATAC samples were prepared using the Nextera DNA library preparation kit (Illumina, #FC-121-1030) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 12.5 μl of a master mix containing 7.5 μl of Nextera PCR Master Mix (Illumina, FC-131-1096) and 2.5μl of each Index primer i7 (Illumina ...
-
bioRxiv - Systems Biology 2023Quote: Sequencing libraries were prepared by tagmenting 10 ng WTA DNA with Nextera XT kit (Illumina #FC-131-1024). Indexing PCR was primed with a nextera i7 index primer (e.g ...
-
bioRxiv - Genomics 2023Quote: ... Pooled male and pooled female libraries were constructed using a Truseq nano kit (Illumina, ref. FC-121-4001) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The amplified fragments were sequenced using a 150-cycle MiniSeq High Output Reagent Kit (Illumina, FC-420-1002) on an Illumina MiniSeq ...
-
bioRxiv - Microbiology 2023Quote: ... The amplified barcodes were sequenced using a 75-cycle MiniSeq High Output Reagent Kit (Illumina, FC-420-1001) on an Illumina MiniSeq at Michigan State University ...
-
ATP-dependent citrate lyase Drives Left Ventricular Dysfunction by Metabolic Remodeling of the HeartbioRxiv - Molecular Biology 2024Quote: ... using a HiSeq 3000/4000 SBS 300-cycle kit (Cat#FC-410-1003, Illumina, Inc., San Diego, CA) for 2×150 paired-end reads ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The whole plasmid sequences were verified using Nextera XT DNA library prep kit (Illumina, Catalog #FC-131-1096) or whole plasmid sequencing services provided by Plasmidsaurus Inc ...
-
bioRxiv - Physiology 2024Quote: ... The libraries were sequenced on Illumina NextSeq500 in a single-end 75-bp format (FC-404-2005, Illumina). Single-nuclei libraries were sequenced at an average depth of 3 mio reads.
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... and an independent validation set (3 Illumina HumanMethylation450K array studies ...
-
bioRxiv - Genomics 2024Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were counted and 50,000 cells were isolated for processing with the Nextera Tn5 enzyme (Illumina FC-131-1096) as previously described (Buenrostro et al. ...
-
bioRxiv - Genomics 2020Quote: ... 0.5 μl of each index primers i5 and i7 from Nextera Index Kit (Illumina, catalog no. FC-121-1011) and 1.5 μl H2O ...
-
bioRxiv - Genomics 2020Quote: ... Hiseq3000 SBS&Cluster high-throughput NGS library preparation kit (Cat. No. FC-410-1002, Illumina, San Diego, CA, USA), (VAHTS Universal DNA Library Prep Kit (ND608-01 ...