Labshake search
Citations for Illumina :
451 - 500 of 1011 citations for Fc Receptor Like Protein 3 FCRL3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 0.5 μl of each index primers i5 and i7 from Nextera Index Kit (Illumina, catalog no. FC-121-1011) and 1.5 μl H2O ...
-
bioRxiv - Genomics 2020Quote: ... Samples that passed quality checks were tagmented with the Nextera DNA Library Prep Kit (Illumina cat# FC-121-1030). Tagmented samples were cleaned using the QIAquick DNA column (Qiagen cat# 28104) ...
-
bioRxiv - Immunology 2021Quote: ... and amplicons were used to perform the index PCR using the Nextera XT index v2 (Illumina #FC-131-1002). The index PCR products were cleaned with the Agencourt AMPure XP kit (Beckman Coulter #A63881 ...
-
bioRxiv - Neuroscience 2020Quote: ... and sequenced on an Illumina HiSeq 2500 using HiSeq SBS kit v4 250 cycle kit (Illumina, FC-401-4003). A standard Illumina pipeline was used to generate fastq files ...
-
bioRxiv - Physiology 2021Quote: ... Libraries were prepared from ∼150 pg of DNA using the Nextera XT DNA preparation kit (Illumina, FC-131-1096) and Nextera XT 96-Index kit (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were loaded with a concentration of 2.2pM on 75 cycle high output flow cells (Illumina, FC-404-2005) and sequenced on a NextSeq 500/550 (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... and metagenomic DNA sequencing libraries were constructed using the Nextera XT DNA Library Prep Kit (FC-131-1096, Illumina) and sequenced on a NextSeq500 Sequencing System as 2 x 150 nucleotide paired-end reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5μL Tn5 transposase and 22.5μL ddH2O) using reagents from the Nextera DNA library Preparation Kit (Illumina #FC-121-103). Samples were then incubated at 37°C for 30min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nuclei pellets were resuspended gently in transposition reaction mix (25 µL 2X TD Buffer [Illumina Cat #FC-121-1030], 2.5 µL transposase [Illumina Cat #FC-121-1030] and 22.5 µL nuclease-free water ...
-
bioRxiv - Neuroscience 2021Quote: ... Pooled libraries were sequenced using the NextSeq 500/550 High Output v2 kit (75 cycles, Illumina, FC-404-2005) with single reads on a NextSeq500 (Illumina).
-
bioRxiv - Neuroscience 2021Quote: ... nuclei were extracted from cells and treated with transposition mixture containing Nextera Tn5 Transposase for (Illumina, FC-121-1030). Transposed fragments were then purified using QIAGEN MinElute columns (QIAGEN ...
-
bioRxiv - Microbiology 2021Quote: ... and libraries were prepared with a Nextera XT DNA kit (catalog number FC-131-1096; Illumina, San Diego, CA). Normalization ...
-
bioRxiv - Cancer Biology 2021Quote: ... and sequencing was followed previously reported protocols.67,68 The sequencing library was constructed by using the Nextera XT tagmentation kit (Cat# FC-131-1096, Illumina), and the HiSeq2500 instrument (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... Library construction was performed using the Nextera XT Library Prep kit (#FC-131-1024, Illumina, San Diego, California, USA) and custom barcode adapters (sequences available upon request) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 120 μl pooled 20 pM library and 15 μl denatured 20 pM PhiX control library (Illumina, FC-110-3001) after a 2 minute heat treatment at 96 °C followed by a 5 min incubation on ice ...
-
bioRxiv - Genomics 2021Quote: ... Each sample library was uniquely barcoded and quantified by qPCR using a PhiX Control v3 (Illumina, FC-110-3001) standard curve ...
-
bioRxiv - Physiology 2020Quote: ... which was processed into the sequencing library using the Nextera XT DNA Library Preparation Kit (FC-131-1096, Illumina) with unique barcode sequences for each set ...
-
bioRxiv - Cancer Biology 2021Quote: ... Transposed fragments were amplified and purified as described previously (Buenrostro 2015) with Nextera Index Kit (FC-121-1011, Illumina). qPCR was performed to determine the optimal number of cycles to amplify the library to reduce artifacts associated with saturation PCR of complex libraries ...
-
bioRxiv - Genomics 2021Quote: Sequencing libraries were generated using the sequencing kit: TruSeq SBS Kit v5 – GA (36 Cycle) (FC- 104-5001, Illumina). Samples were then sequenced on an Illumina GA-IIx sequencer using paired-end (PE ...
-
bioRxiv - Genomics 2021Quote: ... and tagmented using the enzyme and buffer provided in the Nextera Library Prep Kit (Illumina, cat. FC-121-1031). Tagmented DNA was then purified using the MinElute PCR purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: Tagmentation and indexed library amplification were done with Nextera® XT DNA Library Preparation Kit (Illumina, FC-131-1096) and Nextera® XT Index Kit (96 indexes ...
-
bioRxiv - Immunology 2024Quote: ... Two arrays were sequenced per sequencing run with an Illumina 75 Cycle NextSeq500/550v2 kit (Illumina FC-404–2005) at a final concentration of 2.4 pM ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were pooled in equimolar concentrations and sequenced using an Illumina NextSeq 500/550 sequencer (Illumina, FC-404-2005). At least 95% of the reads generated presented a Q score of ≥ 30 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were added with 50mL trans-position reaction mix of Nextera DNA library preparation kit (FC-121-1031, Illumina). DNA was amplified by PCR and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR-free libraries were prepared from 1μg DNA using the TruSeq PCRfree DNA sample preparation kit (cat# FC-121-3001/3002, Illumina) targeting an insert size of 350bp ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.5 µl of Tagment DNA buffer 1.25 µl of Amplicon Tagment Mix (Nextera XT kit, Illumina FC-131-1096) were added ...
-
bioRxiv - Genomics 2022Quote: ... 600 pg cDNA from each sample plate was used in a modified Nextera XT (Illumina, Cat. FC-131-1024) library preparation but using the P5NEXTPT5 primer and the tagmentation time of 5 mins ...
-
bioRxiv - Genetics 2022Quote: ... Normalised DNA libraries were clustered on Illumina cBot then sequenced using Illumina HiSeq X Ten platform using HiSeq X Ten Reagent Kit v2.5 kits (FC-501-2501, Illumina). Paired end sequencing was performed using the 2×150bp chemistry to achieve an average output of approximately >120 Gb of data per library.
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted to 0.2 ng/ul in TE and tagmented (Nextera XT DNA Library Preparation Kit (#FC-131-1096, Illumina). Indexing was performed using the Nextera XT Index Kit (#FC-131-1001 ...
-
bioRxiv - Cell Biology 2022Quote: ... 10μl of the tagmented chromatin was mixed with 2.5μl of Nextera PCR primer cocktail and 7.5μl of Nextera PCR master-mix (Illumina FC-121-1030) in low-binding PCR tubes ...
-
bioRxiv - Genomics 2024Quote: ... and prepared for sequencing as previously described using the Illumina Nextera XT library preparation kit (Illumina #FC-131-1096) or an in-house library preparation protocol10 ...
-
bioRxiv - Immunology 2024Quote: ... and 200 pg of cDNA was used to generate sequencing libraries with the NexteraXT kit (Illumina, FC-121-10300). Libraries were quantified by qPCR and bioanalyzer traces ...
-
bioRxiv - Neuroscience 2024Quote: ... and sequenced on an Illumina HiSeq 4000 sequencer using the HiSeq 4000 SBS Kit (ref. FC-410-1001; Illumina) chemistry ...
-
bioRxiv - Genetics 2024Quote: ... Sequencing libraries were constructed using the NexteraXT DNA library preparation kit with unique dual indexes (Illumina, FC-131-1096) to generate Illumina-compatible barcoded libraries ...
-
bioRxiv - Cancer Biology 2024Quote: ... diluted to 650 pM in RSB buffer and mixed with 1% PhiX Control v3 DNA (Illumina FC-110-3001) for sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclei were collected by centrifugation and resuspended in transposition reaction mix containing Tn5 transposase (Illumina, cat# FC-121-1030) and incubated at 37°C for 30 mins ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2024Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...