Labshake search
Citations for Illumina :
301 - 350 of 492 citations for Mouse IgG1 Isotype Control Antibody 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and clustered on an Illumina Novaseq 6000 S4 flow cell followed by 150bp paired-end sequencing with inclusion of 10-15% spike-in PhiX Control v3 library (Illumina). Controlled access to DNase-seq ...
-
bioRxiv - Systems Biology 2023Quote: ... the final library was diluted to 20 nM with HT1 buffer and PhiX control v3 (20%, v/v) and 600 µL was loaded onto a MiSeq v2 (500 cycles) reagent cartridge (Illumina). The resulting sequences were uploaded to Illumina Sequence Hub and downloaded using BaseSpace Sequence Hub Downloader (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... CUT&RUN libraries (10–20 Mio reads per sample and 1/3 of reads for the controls) were sequenced on a NovaSeq 6000 (Illumina) paired end 100 bp at the Deep Sequencing Facility (Max Planck Institute for Immunobiology and Epigenetics ...
-
bioRxiv - Molecular Biology 2024Quote: ... The libraries were adjusted to 10 pM spiked in with 15% PhiX Control v3 Library and sequenced on the NextSeq550 and HiSeq2500 (Illumina) platform (R1 – 54 cycles ...
-
bioRxiv - Genetics 2023Quote: ... The mm10 mouse genome manifest from Illumina was used as reference ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 technical replicates per library) were sequenced on the HiSeq2500 (HiSeq Control Software 2.2.58/RTA 1.18.64, Illumina Inc., San Diego, CA, USA) with a 1×51 setup in RapidRun mode using ‘HiSeq Rapid SBS Kit v2’ chemistry.
-
bioRxiv - Microbiology 2019Quote: ... Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike in (PhiX Control v3 Illumina Catalogue FC-110-3001). Whole genome sequencing data has been deposited in the Sequence Read Archive under PRJNA529870.
-
bioRxiv - Genetics 2019Quote: ... MS-103-2003) at a concentration of 15 nM with an addition of 25% Phix Control v3 (Illumina, FC-11-2003).
-
bioRxiv - Molecular Biology 2021Quote: ... Libraries from knockout FL83B cells and their corresponding non-targeting controls were prepared with TruSeq Stranded mRNA Library Kit (Illumina, #20020595), pair-end sequencing was performed using the NovaSeq 6000 (Illumina) ...
-
bioRxiv - Microbiology 2020Quote: ... Single-end sequencing using 125 bp read length was performed on an Illumina HiSeq 2500 platform (Illumina HiSeq Control Software 2.2.38) using an Illumina HiSeq Flow Cell v4 and TruSeq SBS Kit v4 (Illumina) ...
-
bioRxiv - Systems Biology 2021Quote: ... The pooled libraries were mixed with 15% PhiX control according to the protocol provided by Illumina (Illumina, San Diego, CA, USA) and sequenced on a single MiSeq (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... where T1D case cohorts were matched to population control cohorts based on genotyping array (Affymetrix, Illumina Infinium, Illumina Omni, and Immunochip) and country of origin where possible (US ...
-
bioRxiv - Genomics 2019Quote: ... paired-end mode with R1 67 and R2 8) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries from each plate were pooled in equal concentration (barring positive and negative controls, which were pooled in lower concentrations) and sequenced on a NovaSeq 6000 (Illumina, Inc.) at 2×150 reads.
-
bioRxiv - Microbiology 2023Quote: ... Samples were equimolarly pooled with 10% PhiX control DNA and sequenced on an Illumina MiSeq using a MiSeq 2 × 250 v2 kit (Illumina, Inc.). Due to the number of samples ...
-
bioRxiv - Biophysics 2023Quote: ... 100-120 μl pooled-denatured 20 pM library and 10-20 μl 20 pM PhiX control library (Illumina, FC-110-3001) to provide a reasonable spot density in general ...
-
bioRxiv - Neuroscience 2023Quote: ... and a duplicate unrelated control sample was diluted to 5 ng/µl in low TE provided in AmpliSeq Library PLUS (384 Reactions) kit (Illumina, 20019103). AmpliSeq was carried out following the manufacturer’s protocol (document 1000000036408v07) ...
-
bioRxiv - Genomics 2020Quote: ... and mouse libraries on a NextSeq 500 (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... Barcoded treatment and control replicate libraries were hybridized across four lanes of two S4 flow cells for cBot (Illumina, San Diego, CA) cluster generation and sequencing (paired-end ...
-
bioRxiv - Genomics 2020Quote: ... 10 pM DNA library was prepared under Denature and Dilute Libraries Guide of Illumine MiSeq System with 15% PhiX spike-in control (Illumina, CA, USA) and eventually subjected to 250 bp pair-end sequencing on a MiSeq lane (Illumina ...
-
bioRxiv - Cancer Biology 2020Quote: ... A total of 12 libraries from persistently infected cells and control were generated and sequenced using HiSeq2000 Illumina platform following manufacturer’s instruction (Illumina Inc., San Diego).
-
bioRxiv - Pathology 2022Quote: ... The RNA resultant from RIP of heart tissue or resultant from NHDF transfection with hnRNPC siRNA and the respective control construct was sequenced on an Illumina Nextseq 550 sequencer (Illumina, CA, USA) to 25-35 million single-end 75bp reads and >50 million paired-end 75 bp reads per sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Cancer Biology 2020Quote: ... Drop-seq denatured libraries were loaded at 1.3pM final concentration and were spiked in with 10% of 1.8pM PhiX Control v3 (Illumina Cat# FC-110-3001). Sequencing specifications were as follows ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... trim regions with average quality scores below Q10 from both ends of reads and to filter out reads aligning to PhiX-174 genome (a commonly used spike-in control in Illumina sequencing runs). After filtering ...
-
bioRxiv - Genomics 2019Quote: ... libraries were prepared according to the manufacturer’s instructions with a 1% spike-in of the ϕX174 control library (Illumina #FC-110-3002) and sequenced on an Illumina NextSeq 500 instrument with a High Output v2 reagent kit (Illumina #FC-404-2005) ...
-
bioRxiv - Molecular Biology 2022Quote: ... After quality control and equimolar pooling paired-end sequencing of the libraries was performed on a NextSeq (Illumina, San Diego, CA, USA) instrument with NextSeq 500 High Output v2 Kit to generate 2×150 read lengths according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and finally sequenced with phiX as control using paired-end 2×250-bp chemistry on the Illumina MiSeq 2000 platform (Illumina Inc., USA)
-
bioRxiv - Microbiology 2023Quote: ... The quantified and denatured libraries were sequenced using paired-end 2×250-bp chemistry with 5% PhiX as an internal control on the Illumina MiSeq 2000 platform (Illumina Inc., USA). The quality-filtered reads were de-novo assembled using SPAdes (version 3.11.1) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Genomic DNA was extracted from Bergerac and N2 control lines as previously described (Konrad et al. 2018) with libraries prepared using the Nextera DNAflex library kit (Illumina, San Diego, CA). Libraries were sequenced on the Illumina Novaseq6000 platform (2×150 bp ...
-
bioRxiv - Microbiology 2020Quote: ... paired-end 300 bp amplicon sequencing of the pooled heavy fractions for three 13C-samples per sample site/substrate combination and the pooled heavy and light fractions for all 12C-controls was completed on an Illumina MiSeq sequencer (Illumina, San Diego, CA). For metagenomes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Short-read whole-genome sequencing and library preparations for tumors and matched germline control were performed according to the manufacturer’s instructions (Illumina, San Diego, CA, USA). The quality of the libraries was assessed using a Bioanalyzer (Agilent ...
-
bioRxiv - Microbiology 2020Quote: ... The pool was sequenced on an Illumina MiSeq using the 2 × 250 bp v2 kit with a 10% PhiX control following the manufacturer’s protocol (Illumina, Inc., San Diego, CA) and using custom primers developed from (55) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced on Illumina next-generation sequencing platforms with a 20% spike-in of PhiX control DNA (Illumina, cat. no. FC-110-3001). All sequencing runs used a dual-index configuration and a custom Read 1 primer (5’ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAG 3’ ...
-
bioRxiv - Immunology 2022Quote: ... and pooled to form an equimolar sequencing library that was denatured and diluted to 1.2 pM with a 20% PhiX v3 control library (Illumina, Cat#FC-110-3001), as described in the Illumina Denature and Dilution protocol (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The diluted library was combined with the subsequent PhiX control v3 (20%, v/v) and loaded onto a MiSeq v2 (500 cycles) reagent cartridge (Illumina, Carlsbad, CA, USA). The resulting sequences were uploaded to BaseSpace (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: ... Library pools were mixed with Illumina PhiX control libraries and sequenced using the Illumina MiSeq or HiSeq platforms (Illumina, San Diego, CA, USA) at JAMSTEC or Macrogen (Seoul ...
-
bioRxiv - Microbiology 2024Quote: ... using the standard procedure recommended by the manufacturer with a 0.5% addition of the PhiX control library (Illumina, cat. no. FC-110-3001).
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed using Pair-end 2×100 cycle mode on the Illumina NovaSeq 6000 system (NovaSeq 6000 S1 Reagent Kit v1.5 200 cycles Illumina, cat. no. 20028317; 0.5% of the PhiX control library, Illumina, cat. no. FC-110-3001) and the standard clustering procedure.
-
bioRxiv - Neuroscience 2023Quote: ... Mouse GRCm38/mm10 genome annotation was accessed from Illumina’s iGenomes repository (available at https://support.illumina.com/sequencing/sequencing_software/igenome.html ...
-
bioRxiv - Genomics 2020Quote: ... The pool was denatured with sodium hydroxide according to Illumina recommendation and spiked with 5% PhiX (PhiX control v3 Illumina Catalogue FC-110-3001) before loading (Fig 1).
-
bioRxiv - Immunology 2019Quote: ... The eight capture pools were then pooled equimolar and sequenced across two Illumina HiSeq2500 v2 150bp single-end rapid lanes with a ten percent PhiX control library spike (Illumina Inc., San Diego, CA). Basecall files (bclfiles ...
-
bioRxiv - Microbiology 2019Quote: ... normalised and denatured libraries spiked with 2% PhiX Control Library were sequenced using the CSIRO AAHL MiniSeq Sequencing System (Illumina, San Diego, CA, USA) using the High-Output Reagent kit (300-cycles) ...
-
bioRxiv - Molecular Biology 2022Quote: ... miRNA libraries were prepared from the isolated EV RNA and a water control using the TruSeq Small RNA Library Preparation Kit (RS-200-0012, Illumina, San Diego, CA, USA) using the manufacturer instructions with the modification of performing the adaptor ligation in the presence of 15% polyethylene glycol in order to reduce bias by driving the ligation reactions towards completion as determined by the Extracellular RNA Communication Consortium (46) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 16 PCR positive controls) was sequenced on an Illumina MiSeq® using a MiSeq Reagent Kit v3 (600-cycle) (Illumina, Inc, CA, USA). Raw sequence reads were demultiplexed using a custom Python script ...
-
bioRxiv - Genetics 2019Quote: LBD cases and controls were genotyped for ongoing projects at the Neurodegenerative Diseases Research Unit (NDRU) using the NeuroChip genotyping array (Illumina, San Diego, CA, USA). Genotyping was performed as previously described (Blauwendraat et al ...
-
bioRxiv - Genomics 2021Quote: ... Illumina Catalogue FC-404-2003) following the Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike (PhiX Control v3 Illumina Catalogue FC-110-3001).
-
bioRxiv - Genomics 2022Quote: ... Illumina Catalogue FC-404-2003) following the Illumina recommended denaturation and loading recommendations which included a 1 % PhiX spike in (PhiX Control v3 Illumina Catalogue FC-110-3001). Data was uploaded to Basespace (www.basespace.illumina.com ...