Labshake search
Citations for Illumina :
301 - 350 of 1545 citations for 3 7 Diethyl 2 hydrazinoquinoline hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: To process the bacterial sequencing data (Illumina Miseq©, 2*250 bp), we used the FROGS pipeline [15] ...
-
bioRxiv - Microbiology 2022Quote: ... and sequenced using 2×300 bp reads on a MiSeq instrument (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were sequenced using 2×150 cycles on a NovaSeq 6000 (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were sequenced using 2×150 cycles on a NovaSeq 6000 (Illumina).
-
bioRxiv - Developmental Biology 2022Quote: ... paired-end (2 × 150 bp) sequencing on a NovaSeq 6000 platform (Illumina). Raw sequence reads were processed using an in-house developed pipeline ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end 2×50 bp sequencing performed using a HiSeq2500 system (Illumina). Data quality control performed using FastQC v0.11.8 ...
-
bioRxiv - Cell Biology 2022Quote: ... Library preparation (NexteraXT kit) and paired-end sequencing (Illumina HiSeq, 2×150bp) was performed by Azenta Life Sciences (Indianapolis ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 x 150 pair-end sequencing was performed using the HiSeq2500 (Illumina) with recommended protocol ...
-
bioRxiv - Genomics 2020Quote: ... with the respiratory virus oligo panel including SARS-CoV-2 probes (Illumina, San Diego ...
-
bioRxiv - Developmental Biology 2020Quote: ... and paired end-sequenced (2×75 bp) on the HiSeq 2500 (Illumina). Experiment 1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The sequencing was outsourced (GENEWIZ Illumina NovaSeq/HiSeq 2×150 bp sequencing), generating a 20 million paired-end reads per replicate ...
-
bioRxiv - Immunology 2020Quote: ... using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3). Sequence analysis and assembly of lineage trees were performed using an in-house custom analysis pipeline as previously described (39 ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by the addition of 25 µl of 2× TD buffer (Illumina) and 7.5 µl of Nextra Tn5 transposase (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 stocks were deep sequenced on a MiSeq platform (Illumina). SARS-CoV-2 whole-genome amplicon-based sequencing was conducted by adapting an existing whole genome sequencing pipeline for poliovirus genotyping as described (Wang et al. ...
-
bioRxiv - Immunology 2022Quote: ... with the NextSeq 500/550 High Output 2×75 cycles kit (Illumina). All sequenced samples were quality assessed by capillary electrophoresis with the Agilent RNA 2100 Nano kit (Bioanalyzer ...
-
bioRxiv - Cancer Biology 2023Quote: ... or paired-end (2 × 100 bp) on the Novaseq 6000 platform (Illumina).
-
bioRxiv - Genomics 2023Quote: ... the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA) was used for library preparation following the low-throughput protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The retained libraries were sequenced using MiSeq V3 (2 × 300 bp) (Illumina).
-
bioRxiv - Systems Biology 2023Quote: ... The paired-end sequencing (150 bp × 2) was performed with Novaseq6000 (Illumina) by Chemical Dojin Co ...
-
bioRxiv - Plant Biology 2023Quote: ... and sequencing was performed using MiSeq 2 × 250 cycle paired-end (Illumina) with the Nano Kits v3 reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... depending on library complexity) or NovaSeq (SP 2×250 cycles) platform (Illumina).
-
bioRxiv - Genomics 2023Quote: ... followed by paired-end sequencing (2 × 150 bp) on a NextSeq2000 (Illumina) instrument ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were paired-end sequenced (2×75 bp) on a NextSeq500 (Illumina). BclToFastq was used for the preprocessing of the raw data (trimming and filtering) ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced (paired-end 2×75-bp) in a NextSeq500 instrument (Illumina). Alignment to the reference genome sequence of Listeria monocytogenes EGDe (RefSeq ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Immunology 2023Quote: ... We sequenced the libraries on 2 lanes of a NovaSeq S4 (Illumina), aligned using CellRanger (10X Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... and sequenced with 2 × 250 bp reads on a MiSeq system (Illumina) at the DNA Sequencing Facility of the American University of Beirut ...
-
Braf-mutant Schwann cells divert to a repair phenotype to induce congenital demyelinating neuropathybioRxiv - Developmental Biology 2024Quote: ... We sequenced at 2*76 base-pairs on a NovaSeq 6000 (Illumina) (from mouse sciatic nerves ...
-
Braf-mutant Schwann cells divert to a repair phenotype to induce congenital demyelinating neuropathybioRxiv - Developmental Biology 2024Quote: ... or on at 2*101 base-pairs on a NovaSeq 6000 (Illumina) (from hiPSC-derived SC).
-
bioRxiv - Immunology 2024Quote: ... samples were sequenced at 2×150 bp using NovaSeq 6000 system (Illumina).
-
bioRxiv - Evolutionary Biology 2024Quote: ... and sequenced on a HiSeq X (Illumina, paired-end 2 × 150 pb).
-
bioRxiv - Developmental Biology 2024Quote: ... Paired-end reads (2×150 nt) were generated by HiSeq 4000 (Illumina) at the UCSF Center for Advanced Technology (CAT ...
-
bioRxiv - Immunology 2024Quote: ... Sequencing libraries were prepared using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3 ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNAs were prepared using the single cell 3’ Protocol as per manufacturer’s instructions and sequenced on a NextSeq 500 instrument (Illumina) or NovaSeq instrument (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing libraries were prepared using the Chromium Single Cell 3’ v2 kit and sequenced on a HiSeq system (Illumina) at Institut Curie NGS facility ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 12 µl of extracted RNA was depleted of rRNA using Ribo-Zero Gold H/M/R (Illumina) and then reverse-transcribed using random hexamers and SuperScript IV (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: 3′-scRNAseq was completed using Chromium Next GEM single cell 3′ GEM library and Gel bead Kit v3.1 (10x Genomics) and sequenced using a NextSeq 500 (Illumina) at Genomics Birmingham (University of Birmingham) ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by library preparation according to the manufacturer’s recommendations (Single Cell 3’ V3 assay) and sequencing on a HiSeq4000 instrument (Illumina). Libraries were de-multiplexed ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The full-length cDNA were synthesized using the Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 and sequenced by Illumina HiSeq X Ten platform by Gene Denovo Biotechnology Co ...
-
bioRxiv - Physiology 2022Quote: ... cDNAs were prepared using the single cell 3’ Protocol as per manufacturer’s instructions and sequenced on a NovaSeq 6000 (Illumina) with 26 bases for read1 and 98×8 bases for read2.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng RNA was prepared with a commercially available kit according to the manufacturer’s instruction (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina ...
-
bioRxiv - Immunology 2020Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina, San Diego, CA) to perform the sequencing.
-
bioRxiv - Evolutionary Biology 2021Quote: ... DNA sequencing was performed on an Illumina MiSeq at RBGK with version 3 chemistry (Illumina, San Diego, CA, USA) and ran for 600 cycles to generate 2 × 300 bp paired-end reads ...
-
bioRxiv - Pathology 2021Quote: ... Single cell transcriptome libraries of liver cells were prepared with Chromium Single Cell 3’ NextGEM Reagent Kit v3.1 (10X Genomics) to performed sequencing on NextSeq 550 (Illumina) and demultiplexing pipeline with CellRanger v5.0.0 (10x Genomics) ...
-
bioRxiv - Microbiology 2022Quote: ... Short-read sequencing of strain 3-1B was conducted on the Illumina MiSeq platform (Illumina, San Diego, CA, USA) using the NEBNext Ultra II FS DNA library prep kit (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... The library was spiked with 10% of 12.5 pM PhiX and sequenced using 150 cycles of MiSeq version 3 chemistry (Illumina).