Labshake search
Citations for Illumina :
301 - 350 of 1129 citations for 1 Benzyl 3 Tert Butyldimethylsilyl Oxy Methyl Piperidin 4 One since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Developmental Biology 2024Quote: ... and day 3 RNA using the TruSeq Stranded mRNA Library Prep Kit (Illumina 20020594) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... 3nM libraries were loaded across 4 lanes on the HiSeq 4000 (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 4 out of 49 samples only had microarray genotype data from Illumina Omni2.5 chips ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The final library was diluted to 4 nM using Resuspension Buffer (Illumina). The rest of the library preparation was completed following the Denature and Dilute Libraries Guide for MiniSeq System by Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Plant Biology 2021Quote: ... A total of 20 RNA-Seq libraries (one per individual) were prepared with the TruSeq RNA Library Preparation Kit v2 (Illumina, San Diego, CA, USA) using 0.5 μg of starting RNA and aiming at a median insert size of ∼ 155 bp (standard fragmentation protocol) ...
-
bioRxiv - Genomics 2022Quote: ... Canada prepared and sequenced four additional libraries: one paired-end (PE) library with 550 bp inserts using a Nano kit (Illumina, San Diego, CA, USA) and three mate-pair (MP ...
-
bioRxiv - Genomics 2021Quote: Six Illumina RNA-Seq libraries (one for each organ) were constructed from 500ng total RNA using the TruSeq Stranded mRNA kit (Illumina, San Diego, CA, USA), which allows for mRNA strand orientation (the orientation of sequences relative to the antisense strand is recorded) ...
-
bioRxiv - Genomics 2022Quote: ... the sequencing was performed with paired-end sequencing of 150nt each end on one lane of Illumina NovaSeq 6000 (Illumina, San Diego, CA, USA) per sample ...
-
bioRxiv - Microbiology 2022Quote: ... A total of 21 isolates were selected (one representative from each cluster) for whole-genome sequencing using the Illumina NovaSeq 6000 (Illumina, San Diego, CA, USA) platform ...
-
bioRxiv - Plant Biology 2022Quote: ... The GBS library was diluted to 3.6 pM and sequenced on one lane (single end, 101 base pair read length) of an Illumina HiSeq 2500 (Illumina Inc, San Diego, CA) at the Genomics Resources Core Facility (Weill Cornell Medicine ...
-
bioRxiv - Genetics 2023Quote: ... Individual libraries were pooled 30-plex at equimolar concentrations and sequenced on one lane of an Illumina HiSeq 2500 (Illumina, Inc, San Diego, CA) employing a paired-end ...
-
bioRxiv - Plant Biology 2023Quote: ... as per manufacturer’s instructions except that reaction volumes were scaled by one-half and 12 PCR cycles were used for library amplification (Illumina, San Diego, California, USA). Paired-end sequencing (2 × 150 bp ...
-
bioRxiv - Genomics 2023Quote: ... where all 184 samples were merged into one flow cell and sequenced using 100bp single-end mRNA sequencing (RNA-seq) on Illumina Hiseq 2500 (Illumina, San Diego, CA, USA).
-
bioRxiv - Genomics 2024Quote: ... for sequencing with one lane of Pair-End 150 (PE150) sequencing run per species using Illumina HiSeq X-Ten sequencer (Illumina, Sand Diego, CA, USA).
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).
-
bioRxiv - Genomics 2021Quote: ... One RNA-seq library was constructed for each tissue using the NEBNext® Ultra™ || Directional RNA Library Prep Ki (Illumina, San Diego, Calif., USA) and sequenced with a 2 × 100bp (paired-end ...
-
bioRxiv - Genetics 2022Quote: ... then pooled them and sequenced the 2×75 bp paired-end libraries on one Flowcell of an Illumina NextSeq 550 with a High Output v2 kit (150 cycles) (Illumina Inc., San Diego, California, USA).
-
bioRxiv - Microbiology 2024Quote: ... cDNA libraries were multiplexed and clustered in one lane of a flow cell for sequencing on a MiSeq® System (Illumina, San Diego, CA, U.S.A.) with 2 × 300 bp paired-end (PE ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 nM 10X scATAC-seq library was sequenced on a NextSeq500 platform (Illumina) using NextSeq 500/550 High Output Kit v2.5 (75 Cycles ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 nM 10X scRNA-seq libraries were sequenced on a NextSeq500 platform (Illumina) using NextSeq 500/550 High Output Kit v2.5 (150 Cycles ...
-
bioRxiv - Biophysics 2022Quote: ... The sequencing (Step 4) was performed using a Hi-Seq sequencer (Illumina, US) and the data was then filtered using the framing sequence ACAC with a quality score larger then 20 and analyzed (Step 5 ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 ATAC-seq libraries were sequenced per lane in HiSeq 2500 System (Illumina) to generate paired-end 50-bp reads ...
-
bioRxiv - Microbiology 2024Quote: ... DNA from the V3-4 region was amplified using a primer set (Illumina, San Diego ...
-
bioRxiv - Cancer Biology 2022Quote: ... We prepared barcoded libraries for each sample and then pooled the libraries to perform asymmetric 400 + 100 bp paired-end IgSeq in one run using Miseq Reagent Kit V3 (Illumina, Miseq Reagent Kit V3, 600-cycles) on Illumina MiSeq platform.
-
bioRxiv - Cell Biology 2021Quote: ... and 3 cycles of PCR for incorporation of unique dual indices (NEBNext multiplex oligos for Illumina) to the final libraries ...
-
bioRxiv - Cancer Biology 2021Quote: ... Both libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD from Illumina, following the standard protocol ...
-
Three Distinct Transcriptional Profiles of Monocytes Associate with Disease Activity in SSc PatientsbioRxiv - Genomics 2022Quote: ... Both full-length and 3’ RNA- seq libraries were sequenced on a NextSeq 500 instrument (Illumina) with 5-10 x 106 aligned reads per sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina) to perform the sequencing.
-
bioRxiv - Genomics 2021Quote: ... and dual-indexed 3’ digital gene expression (DGE) sequencing libraries were prepared using Nextera XT (Illumina). Libraries were sequenced on a NovaseqS4 or NovaseqS2 with a paired end read structure (R1 ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Genetics 2020Quote: ... 3 groups in total) and constructed using the Illumina TruSeq Stranded Small RNA Sequencing kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Paired- end single cell 3’ gene expression libraries were sequenced on a Novaseq 6000 System (Illumina) using a NovaSeq S1 flow-cell to a depth of at least 3.5 × 108 reads/timepoint.
-
bioRxiv - Microbiology 2022Quote: ... and 3 μg of the product was processed using the TruSeq RNA Sample Preparation Kit (Illumina). Purification of mRNA was performed using polyT oligo-attached magnetic beads ...
-
bioRxiv - Genomics 2023Quote: scRNA-seq library preparation was performed using 10x Genomics Chromium 3’ single cell library protocol (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...