Labshake search
Citations for Illumina :
301 - 350 of 1080 citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was tagmented in 5 technical replicates of 1 ng cDNA each using the Nextera XT Kit (Illumina), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then lysed and fragmented in a single reaction (12.5 µl 2X Illumina TDE buffer, 2.5 µl 1% Tween-20, 2.5 µl 0.2% Digitonin, 5 µl water, 2.5 µl Illumina TDE1 enzyme). Samples were incubated at 37°C for 60 minutes and purified using the Zymo DNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 µL primer P5 (5 µM) and 2.5 µL Index 1 primer (N7**, Illumina, CN FC-131-2001) was used for the PCR enrichment ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The chromatin was then tagmented by resuspending beads in 29 µl Tagmentation Buffer (10 mM Tris-HCl pH 8.0, 5 mM MgCl2, 10% dimethylformamide) and adding 1 µl of transposase (Illumina). Samples were incubated at 37 °C for 10 min and the reaction was terminated by adding 150 µl RIPA buffer ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of Index primer (both provided in NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2), and 25 μl NEBNext Ultra II Q5 Master Mix (PCR cycling conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 ul of Tn5 tagmentation mix (1X Tagment DNA buffer, Illumina; ATM mix, Illumina and cDNA library 1 ng) was prepared for cDNA fragmentation ...
-
bioRxiv - Genetics 2020Quote: ChIP-seq and DNase-seq libraries were prepared from 1-5 ng ChIP DNA or DNase DNA samples using NEBNext Ultra II DNA library Prep Kit (Illumina). Libraries were sequenced on an Illumina NextSeq 500 with single-end or paired-end 75 bp reads.
-
bioRxiv - Genomics 2021Quote: ... Following immunoprecipitation with Dynabeads Protein G beads (invitrogen) in PCR tubes, samples were subject to Tagmentation (5 µl Tagmentation Buffer, 1 µl Tagmentation DNA Enzyme (Illumina), 19 µl Nuclease free water ...
-
bioRxiv - Systems Biology 2020Quote: ... Sequencing was performed using custom read primer oligo1210 (5’-CTTGTGGAAAGGACGAAACACCGGTAATTTCTACTCTTGTAGAT) (HPLC purified, Integrated DNA Technologies) using NextSeq 1 × 75 nt High Output reagents (Illumina).
-
bioRxiv - Immunology 2020Quote: ... Use of 250 pg of cDNA with 1/5 reaction of Illumina Nextera XT kit (Illumina, San Diego, CA, USA). The length distribution of the cDNA libraries was monitored using DNA High Sensitivity Reagent Kit on the Perkin Elmer Labchip GX system (PerkinElmer ...
-
bioRxiv - Genetics 2021Quote: ... The bone and reference captured library pools were diluted to 1 pM with a 5% spike-in of PhiX Control V3 (Illumina) for sequencing on a NextSeq 550 (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... the antibody barcode library was pooled at a ratio of 1:5 with the gene expression library and sequenced on a NextSeq 2000 (Illumina) to an average depth of 34,000 reads per cell.
-
bioRxiv - Cancer Biology 2023Quote: RNA-seq libraries were prepared with 0,5-1 µg of total high quality RNA collected from samples and the Illumina Stranded Total RNA Prep kit (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% PhiX loading control (Illumina).
-
bioRxiv - Genomics 2024Quote: ... with 5% PhiX spike-in (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... with 5% PhiX library control (Illumina). Autosmal ranged from 23X to 29X ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biochemistry 2024Quote: ... with 5% phiX (Illumina, FC-110-3001) was loaded to the sequencer ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA solutions of approximately ≥5 ng μL−1 were subjected to the tagmentation reaction using the Nextera DNA Flex Library Prep Kit (Illumina, San Diego, CA) was used at 1/40 scale of the provided protocol ...
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Cell Biology 2024Quote: ... spiked in with 5% PhiX Control v3 (Illumina) and sequenced on an Illumina Novaseq 6000 at a depth of ∼50,000 reads/cell with dual index ...
-
bioRxiv - Microbiology 2024Quote: The preparation of libraries from extracted nucleic acids was carried out using the Nextera XT kit (Illumina) with 15 amplification cycles and paired-end sequencing was performed on a NextSeq 550 device with the read length of 150 bp at each end ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... Genotyping of the VRC cohort and imputation of genetic variants are described in detail elsewhere.55 We interrogated 7,637,921 variants (imputed from 2,783,635 genetic variants with a minor allele frequency ≥ 5%, measured using the Illumina Human Omni 5 BeadChip array, GRCh37) for an association with each of the 166 ToxScan peptides using the penalized quasi-likelihood (PQL ...
-
bioRxiv - Microbiology 2022Quote: Our existing genomics workflow (incorporating sample receipt, nucleic acid extraction, library preparation, short-read sequencing (Illumina NextSeq or MiSeq), and quality control (QC ...