Labshake search
Citations for Illumina :
451 - 500 of 1080 citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Libraries were generated from 2-5 μg of genomic DNA using the TruSeq 2 library preparation kit (Illumina, USA). Two types of libraries were prepared ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded mRNA library preparation kit (Illumina, Inc., Cat No.20020594/5) including poly-A selection ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Genetics 2020Quote: ... Globin and rRNA sequences were depleted from up to 5 µg of treated RNA using Globin-Zero Gold (Illumina), before PolyA selection with NEBNext Poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 µg fragmented RNA was used for ribosomal RNA removal using Ribo-Zero Gold rRNA Removal Kit (MRZG12324 Illumina) according to Illumina’s protocol for TruSeq Ribo Profile Kit (RPHMR12126 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL of the sample was then further diluted and denatured with 5 µL 0.1N NaOH and 490 µL HT1 buffer (Illumina). Samples were sequenced on a HiSeq2500 HighOutput (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the 4nM library pool was denatured with 5 μl 0.2N of NaOH and diluted using the HT1 Hybridization Buffer (Illumina) to a concentration of 8 pM for amplicon samples and 10 pm for whole-genome samples ...
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Pathology 2022Quote: ... Finally, the libraries of multiplexes (control, 5 samples; schizophrenia, 10 samples) were pooled and analyzed using Illumina HiSeq1500 (Illumina).
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dual indexed sequencing libraries were made out of 5 ng cDNA from the above preparations using Illumina Nextera library preparation kit according to manufacturer’s instructions (Illumina). Quality checked and equimolar pooled libraries were sequenced in a HiSeq 4000 Illumina system ...
-
bioRxiv - Cell Biology 2020Quote: ... rRNA was depleted from 5 μg of total RNA using the Ribo-Zero Gold Yeast rRNA Removal Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... since values ΔCq > 5 are not suitable for further downstream processing for Infinium HD FFPE Restore Protocol (Illumina, Inc.) and Infinium MethylationEPIC array (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... and 5K samples were resuspended in 50 μl, 10 μl, and 5 μl of transposition mix (25 μl 2x TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: Gene expression data was generated with the Chromium Single Cell 5’ v3.1 assay (10X Genomics) and sequenced on the NovaSeq 6000 platform (S1 flow cell, Illumina). To generate gene-barcode count matrices ...
-
bioRxiv - Physiology 2024Quote: ... tagmented DNA was amplified by PCR in a reaction mix (5 µL DNA, 2.5 µL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina)) ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were equimolarly pooled and 1.8 pM of the pool with 5% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Cell Biology 2024Quote: ... libraries were equimolarly pooled and 1.8 pM of the pool with 5% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Microbiology 2024Quote: ... to which 5 µl of P7 and P7 of Nextera XT Index Kit v2 index primers (Illumina, Cambridge, UK) and 7 µl of the previous tagmentation reaction were added ...
-
bioRxiv - Genomics 2024Quote: ... libraries were amplified for 5 cycles with 0.5 μl i5 and i7 Nextera adapters (10 μM) following the instructions provided by Illumina. Finally ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries for 5 biological replicates were pooled and 100bp paired end reads were generated on a NovaSeq 6000 (Illumina). Reads were trimmed and quality filtered using TrimGalore with a minimum phred score of 20 then aligned to hg19 using STAR 64 with quantMode to obtain read counts ...
-
bioRxiv - Genetics 2024Quote: ... 5 µg of total RNA for each sample was then processed using the Tru-Seq stranded mRNA kit (Illumina) following manufacturer instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... were pooled at a 1:1:1:etc ratio before sequencing on an Illumina NextSeq 500/550 instrument using a version 2 kit (Illumina). Fastq files were generated for each library in Illumina BaseSpace ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% of PhiX (Illumina) was used as run control ...
-
bioRxiv - Cell Biology 2020Quote: ... Purified cells were lysed in ATAC lysis buffer for 5 min to get nuclei and then transposed with Tn5 transposase (Illumina) for 30 min ...
-
bioRxiv - Microbiology 2021Quote: PCR free shotgun libraries were prepared for each sample from 2.5 ug metagenomic DNAs by Exeter Sequencing Service for the metagenomic sequencing using the TruSeq DNA library Prep Kit (Illumina). The libraries were sequenced to approximately 7GBp using the HiSeq 2500 rapid run mode (2X 250 bp paired end ...
-
Diversified expression of gamma-protocadherins regulates synaptic specificity in the mouse neocortexbioRxiv - Neuroscience 2021Quote: We acquired 212.66 GB clean reads for the 5’ gene expression library and 183.30 GB for the 5’ pcdhg expression library from the sequencing platform NovaSeq 6000 (Illumina, Novogene). 5’ gene expression sequencing data were aligned by Cellranger v3.0.2 (10X Genomics) ...
-
bioRxiv - Genomics 2021Quote: ... cDNA and barcode libraries were checked for quality on an Agilent 4200 TapeStation, quantified by KAPA qPCR, and sequenced on a single lane (95% transcriptome, 5% barcode) on Novaseq6000 (Illumina) to an average depth of 100,000 reads per cell.
-
bioRxiv - Genomics 2021Quote: ... Libraries were pooled and sequenced single-end for 75 cycles on one high-output flow cell of an Illumina NextSeq with 5% PhiX control (Illumina) added to provide sequence diversity ...
-
bioRxiv - Microbiology 2021Quote: ... a PhiX spike-in of 2.5-5% was added to the pools (PhiX Sequencing Control v3; Illumina # FC-110-3001). Samples were run on the Illumina NextSeq 500 ...
-
bioRxiv - Microbiology 2021Quote: ... 50 ng of each amplicon was dual indexed in a 5-cycle PCR reaction using the PCR module and indexed primers from the Nextera kit (Illumina). Resulting libraries were purified on AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 5’ CGT ACA GCG GCT TGT TGG CTG TGA, and fA23M, 5’ GCG CTC CAG CTC CTT CTG CCC ATA, primers to which the Illumina sequencing primer sequences were attached to their 5’ ends) ...
-
bioRxiv - Microbiology 2022Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110-3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Cancer Biology 2020Quote: Genomic DNA from 28 samples in which scDNA-seq data showed at least 5% of homozygously mutated clones were analyzed by Illumina Omni2.5-8 SNP array ...
-
bioRxiv - Molecular Biology 2020Quote: ... nuclei were isolated from 100,000 cells and sequencing adapters were transposed for 30 minutes at 37°C using 5 μl of TDE1 (Nextera Tn5 transposase, Illumina). After PCR and gel purification ...
-
bioRxiv - Genomics 2021Quote: ... The samples were amplified for 5-8 cycles as determined by qPCR for Illumina sequencing using Nextera library preparation kit (Illumina) and samples were paired-end sequenced on HiSeq4000 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... TASSEL 5 GBS v2 pipeline (52) was used to perform the SNP calling of the sequence data obtained from Illumina sequencing ...
-
bioRxiv - Physiology 2021Quote: ... Single-indexed strand-specific cDNA library from total RNA samples (500 ng input with RIN ≥ 5) was prepared using TruSeq Stranded mRNA Library Prep Kit (Illumina) as per directions by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 μg of purified RNA for each sample was processed using the Ribozero rRNA Removal Kit (Gram-negative bacteria) (Illumina) according to the manufacturer’s instructions except that reaction volumes were reduced by 50% ...
-
bioRxiv - Genetics 2021Quote: ... and ribosomal RNA was depleted from 5 ug of total RNA using the Ribo-Zero™ Gold Kit (Illumina, Inc.). Depleted mRNA was fragmented and converted to first strand cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting 10 nM pool was denatured to 10 pmol with 5% PhiX spike-in and sequenced as single-read on HiSeq 2500 (Illumina) in rapid mode for 51 cycles (plus 7 cycles index read ...
-
bioRxiv - Microbiology 2021Quote: ... Total 5 μg of RNA was used for rRNA depletion by using Ribo-Zero™ (Epicentre, Illumina, Madison, WI USA) kit and purified by using Qiagen-RNeasy miniElute (Qiagen GmbH ...
-
bioRxiv - Immunology 2020Quote: ... 0.3 to 0.5 ng of pre-amplified cDNA was used to generate barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) in an 8μL reaction volume ...
-
bioRxiv - Genomics 2021Quote: ... The 20 ul preamp was then mixed with 25 ul TD buffer and 5 ul TDE1 buffer (Nextera kit, FC-131-1096, Illumina) and incubated for 5 min at 55 C and held at 10 C ...
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA (rRNA) was subsequently depleted from each RNA sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and Reverse Library primers (5’CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATC3’, where NNNNNN denotes the barcodes, e.g. Index1 is CGTGAT for Illumina sequencing). Three rounds of agarose gel purification were performed to purify the fragments of 200~650 bp using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing was performed at 5 million reads/sample in single-end mode with 150 nt read length on the NextSeq 500 platform (Illumina) using a Mid output sequencing kit ...